Incidental Mutation 'R7501:Acad9'
ID581456
Institutional Source Beutler Lab
Gene Symbol Acad9
Ensembl Gene ENSMUSG00000027710
Gene Nameacyl-Coenzyme A dehydrogenase family, member 9
Synonyms2600017P15Rik, NPD002, C630012L17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.862) question?
Stock #R7501 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location36065979-36092853 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36088825 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 503 (N503S)
Ref Sequence ENSEMBL: ENSMUSP00000011492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011492] [ENSMUST00000197588]
Predicted Effect probably benign
Transcript: ENSMUST00000011492
AA Change: N503S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000011492
Gene: ENSMUSG00000027710
AA Change: N503S

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
Pfam:Acyl-CoA_dh_N 69 177 1.2e-25 PFAM
Pfam:Acyl-CoA_dh_M 181 282 2e-27 PFAM
Pfam:Acyl-CoA_dh_1 294 445 9.6e-42 PFAM
Pfam:Acyl-CoA_dh_2 309 434 3.6e-12 PFAM
Blast:HisKA 448 550 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000197588
SMART Domains Protein: ENSMUSP00000142995
Gene: ENSMUSG00000027710

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_1 16 155 1.9e-37 PFAM
Pfam:Acyl-CoA_dh_2 31 156 8.4e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA dehydrogenase family. Members of this family of proteins localize to the mitochondria and catalyze the rate-limiting step in the beta-oxidation of fatty acyl-CoA. The encoded protein is specifically active toward palmitoyl-CoA and long-chain unsaturated substrates. Mutations in this gene cause acyl-CoA dehydrogenase family member type 9 deficiency. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a C T 5: 121,518,948 A761T possibly damaging Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Ankrd44 T C 1: 54,649,363 E238G Het
Ap3b2 A T 7: 81,473,446 I440K probably damaging Het
Atp2a1 G A 7: 126,450,172 T566I probably benign Het
B3galnt1 T C 3: 69,575,299 I210V probably benign Het
Bag5 T C 12: 111,710,288 K367R probably benign Het
Cdc25b T C 2: 131,194,160 Y410H probably damaging Het
Cgref1 G T 5: 30,945,456 P7Q probably damaging Het
Cnot6 T C 11: 49,685,332 I136V probably benign Het
Comp A G 8: 70,379,409 D500G possibly damaging Het
Dnah7b T C 1: 46,356,554 L3872P probably damaging Het
Dync2h1 A T 9: 7,175,336 L91Q possibly damaging Het
Fancd2 T C 6: 113,548,403 V280A possibly damaging Het
Fat4 T A 3: 38,958,448 Y2297* probably null Het
Fem1c A T 18: 46,505,801 M378K probably damaging Het
Gata6 A G 18: 11,054,082 T4A probably damaging Het
Gatb G C 3: 85,636,990 V422L probably damaging Het
Gfpt1 T A 6: 87,082,526 D510E probably benign Het
Gm12394 T C 4: 42,791,357 E925G probably damaging Het
Gria4 A T 9: 4,502,436 Y366N probably benign Het
Gucy1b1 T C 3: 82,035,359 H492R probably damaging Het
Hecw2 T C 1: 53,913,872 probably null Het
Hist1h2be A G 13: 23,585,793 I55T possibly damaging Het
Hnrnph1 A C 11: 50,379,556 E62D probably benign Het
Itga2 A G 13: 114,875,559 V274A probably damaging Het
Kdm5d T A Y: 941,488 W1230R probably damaging Het
Lctl A T 9: 64,131,579 M317L probably benign Het
Lrp6 T C 6: 134,486,508 D570G probably damaging Het
Lrrc9 G T 12: 72,449,716 M39I probably damaging Het
Ltbp2 A T 12: 84,830,645 I402N probably damaging Het
Mst1 G A 9: 108,082,549 G297D probably damaging Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Nbr1 G A 11: 101,566,200 R163Q probably damaging Het
Nlrp4f A G 13: 65,194,329 F501L probably damaging Het
Nup133 A C 8: 123,922,414 I563S probably benign Het
Oacyl T G 18: 65,725,298 probably null Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna2 C T 1: 194,643,895 R46C possibly damaging Het
Ppp1r26 T A 2: 28,450,737 D126E probably damaging Het
Prl6a1 A T 13: 27,316,299 R84S possibly damaging Het
Ptprz1 C T 6: 23,001,747 Q1279* probably null Het
Ptx4 C T 17: 25,125,192 T472I possibly damaging Het
Rabgap1l A G 1: 160,700,788 V416A probably damaging Het
Rbfox2 A T 15: 77,105,634 D231E probably benign Het
Reln A T 5: 22,227,638 F121L possibly damaging Het
Rfx7 G A 9: 72,616,772 V415I probably benign Het
Scaf4 A T 16: 90,230,076 M951K unknown Het
Sdf4 T C 4: 155,996,520 probably null Het
Sec16a T C 2: 26,441,851 T51A probably damaging Het
Sema3a A G 5: 13,557,041 N281S probably damaging Het
Snai2 G A 16: 14,706,890 V87I possibly damaging Het
Synj2 T A 17: 5,990,239 S197T possibly damaging Het
Syt6 A T 3: 103,587,702 M328L probably benign Het
Tdrd12 A G 7: 35,478,091 V946A unknown Het
Trat1 A T 16: 48,754,294 probably null Het
Vmn1r75 T A 7: 11,881,070 I243K possibly damaging Het
Vmn2r83 G A 10: 79,491,937 C793Y probably damaging Het
Wnt9a G A 11: 59,328,757 G203D probably damaging Het
Xrn2 T C 2: 147,029,756 I366T probably damaging Het
Zfp280d A G 9: 72,361,942 D787G possibly damaging Het
Zfp706 T C 15: 37,001,925 T53A probably damaging Het
Other mutations in Acad9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Acad9 APN 3 36069762 missense probably benign 0.06
IGL01161:Acad9 APN 3 36090125 missense possibly damaging 0.93
IGL02016:Acad9 APN 3 36088486 critical splice acceptor site probably null
IGL02100:Acad9 APN 3 36081880 missense probably null 1.00
R0098:Acad9 UTSW 3 36073540 missense probably damaging 1.00
R0098:Acad9 UTSW 3 36073540 missense probably damaging 1.00
R0119:Acad9 UTSW 3 36085415 missense probably damaging 0.99
R0499:Acad9 UTSW 3 36085415 missense probably damaging 0.99
R1444:Acad9 UTSW 3 36078508 missense possibly damaging 0.80
R1564:Acad9 UTSW 3 36089429 missense possibly damaging 0.53
R2013:Acad9 UTSW 3 36073588 missense probably damaging 0.97
R2113:Acad9 UTSW 3 36074376 missense probably damaging 1.00
R2412:Acad9 UTSW 3 36073591 missense probably benign 0.26
R2428:Acad9 UTSW 3 36090923 missense probably benign
R4214:Acad9 UTSW 3 36073603 missense probably damaging 0.99
R4291:Acad9 UTSW 3 36066188 missense probably benign 0.14
R4562:Acad9 UTSW 3 36066182 missense probably benign 0.31
R4679:Acad9 UTSW 3 36088840 missense possibly damaging 0.79
R4758:Acad9 UTSW 3 36073605 missense probably damaging 1.00
R4953:Acad9 UTSW 3 36074376 missense probably damaging 1.00
R4970:Acad9 UTSW 3 36085525 missense probably damaging 1.00
R5137:Acad9 UTSW 3 36069771 missense probably benign 0.28
R5171:Acad9 UTSW 3 36074398 missense possibly damaging 0.94
R5956:Acad9 UTSW 3 36075174 unclassified probably benign
R6285:Acad9 UTSW 3 36082175 missense probably benign 0.01
R6620:Acad9 UTSW 3 36066145 missense possibly damaging 0.93
R6880:Acad9 UTSW 3 36069705 splice site probably null
R6995:Acad9 UTSW 3 36085481 missense probably damaging 1.00
R7286:Acad9 UTSW 3 36075990 missense probably damaging 1.00
R7705:Acad9 UTSW 3 36088526 missense probably benign
R8072:Acad9 UTSW 3 36075255 missense probably benign 0.12
R8166:Acad9 UTSW 3 36090083 missense probably benign 0.03
R8199:Acad9 UTSW 3 36085423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCCAGCAGTCATCCTTC -3'
(R):5'- GTCAAGATTTCTGTTCTAAGCCTGG -3'

Sequencing Primer
(F):5'- ACATTTGGTACCCTGCTGCAATG -3'
(R):5'- CTAAGCCTGGTCTCATAGGTG -3'
Posted On2019-10-17