Incidental Mutation 'R7501:B3galnt1'
ID581458
Institutional Source Beutler Lab
Gene Symbol B3galnt1
Ensembl Gene ENSMUSG00000043300
Gene NameUDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 1
SynonymsBrainiac 1, B3galt3, Globoside blood group, Mbrn 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R7501 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location69574158-69598960 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69575299 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 210 (I210V)
Ref Sequence ENSEMBL: ENSMUSP00000058363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061826]
Predicted Effect probably benign
Transcript: ENSMUST00000061826
AA Change: I210V

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000058363
Gene: ENSMUSG00000043300
AA Change: I210V

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Galactosyl_T 92 285 4.5e-68 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the beta-1,3-galactosyltransferase (beta3GalT) gene family. This family encodes type II membrane-bound glycoproteins with diverse enzymatic functions using different donor substrates (UDP-galactose and UDP-N-acetylglucosamine) and different acceptor sugars (N-acetylglucosamine, galactose, N-acetylgalactosamine). The beta3GalT genes are distantly related to the Drosophila Brainiac gene and have the protein coding sequence contained in a single exon. The beta3GalT proteins also contain conserved sequences not found in the beta4GalT or alpha3GalT proteins. The carbohydrate chains synthesized by these enzymes are designated as type 1, whereas beta4GalT enzymes synthesize type 2 carbohydrate chains. The ratio of type 1:type 2 chains changes during embryogenesis. By sequence similarity, the beta3GalT genes fall into at least two groups: beta3GalT4 and 4 other beta3GalT genes (beta3GalT1-3, beta3GalT5). The encoded protein of this gene does not use N-acetylglucosamine as an acceptor sugar at all. [provided by RefSeq, Mar 2017]
PHENOTYPE: A homozygous null mutation of this gene results in embryonic lethality. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 A G 3: 36,088,825 N503S probably benign Het
Adam1a C T 5: 121,518,948 A761T possibly damaging Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Ankrd44 T C 1: 54,649,363 E238G Het
Ap3b2 A T 7: 81,473,446 I440K probably damaging Het
Atp2a1 G A 7: 126,450,172 T566I probably benign Het
Bag5 T C 12: 111,710,288 K367R probably benign Het
Cdc25b T C 2: 131,194,160 Y410H probably damaging Het
Cgref1 G T 5: 30,945,456 P7Q probably damaging Het
Cnot6 T C 11: 49,685,332 I136V probably benign Het
Comp A G 8: 70,379,409 D500G possibly damaging Het
Dnah7b T C 1: 46,356,554 L3872P probably damaging Het
Dync2h1 A T 9: 7,175,336 L91Q possibly damaging Het
Fancd2 T C 6: 113,548,403 V280A possibly damaging Het
Fat4 T A 3: 38,958,448 Y2297* probably null Het
Fem1c A T 18: 46,505,801 M378K probably damaging Het
Gata6 A G 18: 11,054,082 T4A probably damaging Het
Gatb G C 3: 85,636,990 V422L probably damaging Het
Gfpt1 T A 6: 87,082,526 D510E probably benign Het
Gm12394 T C 4: 42,791,357 E925G probably damaging Het
Gria4 A T 9: 4,502,436 Y366N probably benign Het
Gucy1b1 T C 3: 82,035,359 H492R probably damaging Het
Hecw2 T C 1: 53,913,872 probably null Het
Hist1h2be A G 13: 23,585,793 I55T possibly damaging Het
Hnrnph1 A C 11: 50,379,556 E62D probably benign Het
Itga2 A G 13: 114,875,559 V274A probably damaging Het
Kdm5d T A Y: 941,488 W1230R probably damaging Het
Lctl A T 9: 64,131,579 M317L probably benign Het
Lrp6 T C 6: 134,486,508 D570G probably damaging Het
Lrrc9 G T 12: 72,449,716 M39I probably damaging Het
Ltbp2 A T 12: 84,830,645 I402N probably damaging Het
Mst1 G A 9: 108,082,549 G297D probably damaging Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Nbr1 G A 11: 101,566,200 R163Q probably damaging Het
Nlrp4f A G 13: 65,194,329 F501L probably damaging Het
Nup133 A C 8: 123,922,414 I563S probably benign Het
Oacyl T G 18: 65,725,298 probably null Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna2 C T 1: 194,643,895 R46C possibly damaging Het
Ppp1r26 T A 2: 28,450,737 D126E probably damaging Het
Prl6a1 A T 13: 27,316,299 R84S possibly damaging Het
Ptprz1 C T 6: 23,001,747 Q1279* probably null Het
Ptx4 C T 17: 25,125,192 T472I possibly damaging Het
Rabgap1l A G 1: 160,700,788 V416A probably damaging Het
Rbfox2 A T 15: 77,105,634 D231E probably benign Het
Reln A T 5: 22,227,638 F121L possibly damaging Het
Rfx7 G A 9: 72,616,772 V415I probably benign Het
Scaf4 A T 16: 90,230,076 M951K unknown Het
Sdf4 T C 4: 155,996,520 probably null Het
Sec16a T C 2: 26,441,851 T51A probably damaging Het
Sema3a A G 5: 13,557,041 N281S probably damaging Het
Snai2 G A 16: 14,706,890 V87I possibly damaging Het
Synj2 T A 17: 5,990,239 S197T possibly damaging Het
Syt6 A T 3: 103,587,702 M328L probably benign Het
Tdrd12 A G 7: 35,478,091 V946A unknown Het
Trat1 A T 16: 48,754,294 probably null Het
Vmn1r75 T A 7: 11,881,070 I243K possibly damaging Het
Vmn2r83 G A 10: 79,491,937 C793Y probably damaging Het
Wnt9a G A 11: 59,328,757 G203D probably damaging Het
Xrn2 T C 2: 147,029,756 I366T probably damaging Het
Zfp280d A G 9: 72,361,942 D787G possibly damaging Het
Zfp706 T C 15: 37,001,925 T53A probably damaging Het
Other mutations in B3galnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0101:B3galnt1 UTSW 3 69575806 missense probably benign 0.01
R0230:B3galnt1 UTSW 3 69575340 missense possibly damaging 0.80
R1580:B3galnt1 UTSW 3 69575707 missense possibly damaging 0.95
R1628:B3galnt1 UTSW 3 69575628 missense probably damaging 1.00
R1942:B3galnt1 UTSW 3 69575925 start codon destroyed probably null 0.90
R5137:B3galnt1 UTSW 3 69574949 missense probably benign 0.01
R6418:B3galnt1 UTSW 3 69574993 missense probably damaging 1.00
R6468:B3galnt1 UTSW 3 69575533 missense probably damaging 1.00
R6473:B3galnt1 UTSW 3 69575340 missense possibly damaging 0.80
R7236:B3galnt1 UTSW 3 69575617 missense probably benign 0.36
R7363:B3galnt1 UTSW 3 69575824 missense probably damaging 1.00
R7819:B3galnt1 UTSW 3 69575775 missense probably damaging 1.00
R7911:B3galnt1 UTSW 3 69575241 missense probably damaging 1.00
R7999:B3galnt1 UTSW 3 69575215 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAACTTGATGGGCTTCACGTG -3'
(R):5'- CTTGGAGGATGAGCACGTTC -3'

Sequencing Primer
(F):5'- GATGGGCTTCACGTGACTCATC -3'
(R):5'- AGGATGAGCACGTTCTCTATG -3'
Posted On2019-10-17