Incidental Mutation 'R7501:Syt6'
ID 581461
Institutional Source Beutler Lab
Gene Symbol Syt6
Ensembl Gene ENSMUSG00000027849
Gene Name synaptotagmin VI
Synonyms 3110037A08Rik
MMRRC Submission 045574-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.123) question?
Stock # R7501 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 103482561-103552883 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 103495018 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 328 (M328L)
Ref Sequence ENSEMBL: ENSMUSP00000112997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090697] [ENSMUST00000117221] [ENSMUST00000118117] [ENSMUST00000118563] [ENSMUST00000121834] [ENSMUST00000132325] [ENSMUST00000136049] [ENSMUST00000151985] [ENSMUST00000183637]
AlphaFold Q9R0N8
Predicted Effect probably benign
Transcript: ENSMUST00000090697
AA Change: M328L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000088196
Gene: ENSMUSG00000027849
AA Change: M328L

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 93 103 N/A INTRINSIC
C2 246 350 2.65e-20 SMART
C2 378 492 2.25e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117221
AA Change: M243L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113373
Gene: ENSMUSG00000027849
AA Change: M243L

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
C2 293 407 2.25e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118117
AA Change: M243L

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112486
Gene: ENSMUSG00000027849
AA Change: M243L

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
C2 293 407 2.25e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118563
AA Change: M243L

PolyPhen 2 Score 0.241 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113287
Gene: ENSMUSG00000027849
AA Change: M243L

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
Pfam:C2 294 332 3.5e-2 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121834
AA Change: M328L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000112997
Gene: ENSMUSG00000027849
AA Change: M328L

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 93 103 N/A INTRINSIC
C2 246 350 2.65e-20 SMART
C2 378 492 2.25e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132325
SMART Domains Protein: ENSMUSP00000116324
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136049
SMART Domains Protein: ENSMUSP00000118124
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151985
Predicted Effect probably benign
Transcript: ENSMUST00000183637
SMART Domains Protein: ENSMUSP00000138874
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the synaptotagmin family. Synaptotagmins share a common domain structure that includes a transmembrane domain and a cytoplasmic region composed of 2 C2 domains, and are involved in calcium-dependent exocytosis of synaptic vesicles. This protein has been shown to be a key component of the secretory machinery involved in acrosomal exocytosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 A G 3: 36,142,974 (GRCm39) N503S probably benign Het
Adam1a C T 5: 121,657,011 (GRCm39) A761T possibly damaging Het
Amn1 C T 6: 149,086,529 (GRCm39) M44I probably benign Het
Ankrd44 T C 1: 54,688,522 (GRCm39) E238G Het
Ap3b2 A T 7: 81,123,194 (GRCm39) I440K probably damaging Het
Atp2a1 G A 7: 126,049,344 (GRCm39) T566I probably benign Het
B3galnt1 T C 3: 69,482,632 (GRCm39) I210V probably benign Het
Bag5 T C 12: 111,676,722 (GRCm39) K367R probably benign Het
Cdc25b T C 2: 131,036,080 (GRCm39) Y410H probably damaging Het
Cgref1 G T 5: 31,102,800 (GRCm39) P7Q probably damaging Het
Cnot6 T C 11: 49,576,159 (GRCm39) I136V probably benign Het
Comp A G 8: 70,832,059 (GRCm39) D500G possibly damaging Het
Dnah7b T C 1: 46,395,714 (GRCm39) L3872P probably damaging Het
Dync2h1 A T 9: 7,175,336 (GRCm39) L91Q possibly damaging Het
Fancd2 T C 6: 113,525,364 (GRCm39) V280A possibly damaging Het
Fat4 T A 3: 39,012,597 (GRCm39) Y2297* probably null Het
Fem1c A T 18: 46,638,868 (GRCm39) M378K probably damaging Het
Gata6 A G 18: 11,054,082 (GRCm39) T4A probably damaging Het
Gatb G C 3: 85,544,297 (GRCm39) V422L probably damaging Het
Gfpt1 T A 6: 87,059,508 (GRCm39) D510E probably benign Het
Gria4 A T 9: 4,502,436 (GRCm39) Y366N probably benign Het
Gucy1b1 T C 3: 81,942,666 (GRCm39) H492R probably damaging Het
H2bc6 A G 13: 23,769,776 (GRCm39) I55T possibly damaging Het
Hecw2 T C 1: 53,953,031 (GRCm39) probably null Het
Hnrnph1 A C 11: 50,270,383 (GRCm39) E62D probably benign Het
Itga2 A G 13: 115,012,095 (GRCm39) V274A probably damaging Het
Kdm5d T A Y: 941,488 (GRCm39) W1230R probably damaging Het
Lctl A T 9: 64,038,861 (GRCm39) M317L probably benign Het
Lrp6 T C 6: 134,463,471 (GRCm39) D570G probably damaging Het
Lrrc9 G T 12: 72,496,490 (GRCm39) M39I probably damaging Het
Ltbp2 A T 12: 84,877,419 (GRCm39) I402N probably damaging Het
Mst1 G A 9: 107,959,748 (GRCm39) G297D probably damaging Het
Muc6 G C 7: 141,217,659 (GRCm39) P2338R probably damaging Het
Nbr1 G A 11: 101,457,026 (GRCm39) R163Q probably damaging Het
Nlrp4f A G 13: 65,342,143 (GRCm39) F501L probably damaging Het
Nup133 A C 8: 124,649,153 (GRCm39) I563S probably benign Het
Oacyl T G 18: 65,858,369 (GRCm39) probably null Het
Oog4 CAA CA 4: 143,164,022 (GRCm39) probably null Het
Plxna2 C T 1: 194,326,203 (GRCm39) R46C possibly damaging Het
Ppp1r26 T A 2: 28,340,749 (GRCm39) D126E probably damaging Het
Prl6a1 A T 13: 27,500,282 (GRCm39) R84S possibly damaging Het
Ptprz1 C T 6: 23,001,746 (GRCm39) Q1279* probably null Het
Ptx4 C T 17: 25,344,166 (GRCm39) T472I possibly damaging Het
Rabgap1l A G 1: 160,528,358 (GRCm39) V416A probably damaging Het
Rbfox2 A T 15: 76,989,834 (GRCm39) D231E probably benign Het
Reln A T 5: 22,432,636 (GRCm39) F121L possibly damaging Het
Rfx7 G A 9: 72,524,054 (GRCm39) V415I probably benign Het
Scaf4 A T 16: 90,026,964 (GRCm39) M951K unknown Het
Sdf4 T C 4: 156,080,977 (GRCm39) probably null Het
Sec16a T C 2: 26,331,863 (GRCm39) T51A probably damaging Het
Sema3a A G 5: 13,607,008 (GRCm39) N281S probably damaging Het
Snai2 G A 16: 14,524,754 (GRCm39) V87I possibly damaging Het
Spata31f1e T C 4: 42,791,357 (GRCm39) E925G probably damaging Het
Synj2 T A 17: 6,040,514 (GRCm39) S197T possibly damaging Het
Tdrd12 A G 7: 35,177,516 (GRCm39) V946A unknown Het
Trat1 A T 16: 48,574,657 (GRCm39) probably null Het
Vmn1r75 T A 7: 11,614,997 (GRCm39) I243K possibly damaging Het
Vmn2r83 G A 10: 79,327,771 (GRCm39) C793Y probably damaging Het
Wnt9a G A 11: 59,219,583 (GRCm39) G203D probably damaging Het
Xrn2 T C 2: 146,871,676 (GRCm39) I366T probably damaging Het
Zfp280d A G 9: 72,269,224 (GRCm39) D787G possibly damaging Het
Zfp706 T C 15: 37,002,169 (GRCm39) T53A probably damaging Het
Other mutations in Syt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Syt6 APN 3 103,532,942 (GRCm39) missense probably damaging 0.98
IGL02944:Syt6 APN 3 103,482,865 (GRCm39) unclassified probably benign
IGL03168:Syt6 APN 3 103,494,943 (GRCm39) missense probably damaging 1.00
PIT4305001:Syt6 UTSW 3 103,482,769 (GRCm39) missense possibly damaging 0.91
R0124:Syt6 UTSW 3 103,494,842 (GRCm39) missense probably damaging 1.00
R0587:Syt6 UTSW 3 103,532,887 (GRCm39) missense probably damaging 0.99
R0601:Syt6 UTSW 3 103,528,206 (GRCm39) missense probably damaging 1.00
R1262:Syt6 UTSW 3 103,492,656 (GRCm39) critical splice acceptor site probably null
R1970:Syt6 UTSW 3 103,494,736 (GRCm39) missense probably benign 0.21
R4012:Syt6 UTSW 3 103,532,809 (GRCm39) splice site probably benign
R4450:Syt6 UTSW 3 103,492,961 (GRCm39) missense probably benign 0.01
R4493:Syt6 UTSW 3 103,492,946 (GRCm39) missense probably damaging 0.99
R4494:Syt6 UTSW 3 103,492,946 (GRCm39) missense probably damaging 0.99
R4495:Syt6 UTSW 3 103,494,876 (GRCm39) nonsense probably null
R4740:Syt6 UTSW 3 103,532,972 (GRCm39) missense probably damaging 1.00
R4750:Syt6 UTSW 3 103,538,233 (GRCm39) makesense probably null
R5668:Syt6 UTSW 3 103,528,217 (GRCm39) missense probably damaging 1.00
R6185:Syt6 UTSW 3 103,492,844 (GRCm39) missense probably damaging 1.00
R6660:Syt6 UTSW 3 103,532,960 (GRCm39) missense probably damaging 1.00
R7120:Syt6 UTSW 3 103,494,673 (GRCm39) missense probably damaging 1.00
R7307:Syt6 UTSW 3 103,494,788 (GRCm39) missense probably damaging 1.00
R8768:Syt6 UTSW 3 103,492,850 (GRCm39) missense probably benign
R8867:Syt6 UTSW 3 103,534,371 (GRCm39) missense possibly damaging 0.91
R8885:Syt6 UTSW 3 103,532,941 (GRCm39) missense probably benign 0.06
R9068:Syt6 UTSW 3 103,494,825 (GRCm39) nonsense probably null
R9098:Syt6 UTSW 3 103,492,895 (GRCm39) missense probably damaging 0.96
R9361:Syt6 UTSW 3 103,482,679 (GRCm39) unclassified probably benign
Z1177:Syt6 UTSW 3 103,552,431 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GCCAAGGACTTTTGCGGAAG -3'
(R):5'- GTTCCCTATGTACCTCTAGGGG -3'

Sequencing Primer
(F):5'- TTGCGGAAGTTCTGACCC -3'
(R):5'- TACCTCTAGGGGGACAGAGTGC -3'
Posted On 2019-10-17