Mutagenetix > Incidental Mutations

Incidental Mutation 'R7501:Syt6'

581461

Institutional Source

Beutler Lab

Gene Symbol

Syt6

Ensembl Gene

ENSMUSG00000027849

Gene Name

synaptotagmin VI

Synonyms

3110037A08Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.157) question?

Stock #

R7501 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103575231-103645569 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 103587702 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 328 (M328L)

Ref Sequence

ENSEMBL: ENSMUSP00000112997 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090697] [ENSMUST00000117221] [ENSMUST00000118117] [ENSMUST00000118563] [ENSMUST00000121834] [ENSMUST00000132325] [ENSMUST00000136049] [ENSMUST00000151985] [ENSMUST00000183637]

Predicted Effect

probably benign
Transcript: ENSMUST00000090697
AA Change: M328L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000088196
Gene: ENSMUSG00000027849
AA Change: M328L

Domain	Start	End	E-Value	Type
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	93	103	N/A	INTRINSIC
C2	246	350	2.65e-20	SMART
C2	378	492	2.25e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117221
AA Change: M243L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000113373
Gene: ENSMUSG00000027849
AA Change: M243L

Domain	Start	End	E-Value	Type
low complexity region	8	18	N/A	INTRINSIC
C2	161	265	2.65e-20	SMART
C2	293	407	2.25e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000118117
AA Change: M243L

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000112486
Gene: ENSMUSG00000027849
AA Change: M243L

Domain	Start	End	E-Value	Type
low complexity region	8	18	N/A	INTRINSIC
C2	161	265	2.65e-20	SMART
C2	293	407	2.25e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000118563
AA Change: M243L

PolyPhen 2 Score 0.241 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000113287
Gene: ENSMUSG00000027849
AA Change: M243L

Domain	Start	End	E-Value	Type
low complexity region	8	18	N/A	INTRINSIC
C2	161	265	2.65e-20	SMART
Pfam:C2	294	332	3.5e-2	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000121834
AA Change: M328L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000112997
Gene: ENSMUSG00000027849
AA Change: M328L

Domain	Start	End	E-Value	Type
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	93	103	N/A	INTRINSIC
C2	246	350	2.65e-20	SMART
C2	378	492	2.25e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000132325

SMART Domains

Protein: ENSMUSP00000116324
Gene: ENSMUSG00000027849

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000136049

SMART Domains

Protein: ENSMUSP00000118124
Gene: ENSMUSG00000027849

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000151985

Predicted Effect

probably benign
Transcript: ENSMUST00000183637

SMART Domains

Protein: ENSMUSP00000138874
Gene: ENSMUSG00000027849

Domain	Start	End	E-Value	Type
low complexity region	8	18	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the synaptotagmin family. Synaptotagmins share a common domain structure that includes a transmembrane domain and a cytoplasmic region composed of 2 C2 domains, and are involved in calcium-dependent exocytosis of synaptic vesicles. This protein has been shown to be a key component of the secretory machinery involved in acrosomal exocytosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad9	A	G	3: 36,088,825	N503S	probably benign	Het
Adam1a	C	T	5: 121,518,948	A761T	possibly damaging	Het
Amn1	C	T	6: 149,185,031	M44I	probably benign	Het
Ankrd44	T	C	1: 54,649,363	E238G		Het
Ap3b2	A	T	7: 81,473,446	I440K	probably damaging	Het
Atp2a1	G	A	7: 126,450,172	T566I	probably benign	Het
B3galnt1	T	C	3: 69,575,299	I210V	probably benign	Het
Bag5	T	C	12: 111,710,288	K367R	probably benign	Het
Cdc25b	T	C	2: 131,194,160	Y410H	probably damaging	Het
Cgref1	G	T	5: 30,945,456	P7Q	probably damaging	Het
Cnot6	T	C	11: 49,685,332	I136V	probably benign	Het
Comp	A	G	8: 70,379,409	D500G	possibly damaging	Het
Dnah7b	T	C	1: 46,356,554	L3872P	probably damaging	Het
Dync2h1	A	T	9: 7,175,336	L91Q	possibly damaging	Het
Fancd2	T	C	6: 113,548,403	V280A	possibly damaging	Het
Fat4	T	A	3: 38,958,448	Y2297*	probably null	Het
Fem1c	A	T	18: 46,505,801	M378K	probably damaging	Het
Gata6	A	G	18: 11,054,082	T4A	probably damaging	Het
Gatb	G	C	3: 85,636,990	V422L	probably damaging	Het
Gfpt1	T	A	6: 87,082,526	D510E	probably benign	Het
Gm12394	T	C	4: 42,791,357	E925G	probably damaging	Het
Gria4	A	T	9: 4,502,436	Y366N	probably benign	Het
Gucy1b1	T	C	3: 82,035,359	H492R	probably damaging	Het
Hecw2	T	C	1: 53,913,872		probably null	Het
Hist1h2be	A	G	13: 23,585,793	I55T	possibly damaging	Het
Hnrnph1	A	C	11: 50,379,556	E62D	probably benign	Het
Itga2	A	G	13: 114,875,559	V274A	probably damaging	Het
Kdm5d	T	A	Y: 941,488	W1230R	probably damaging	Het
Lctl	A	T	9: 64,131,579	M317L	probably benign	Het
Lrp6	T	C	6: 134,486,508	D570G	probably damaging	Het
Lrrc9	G	T	12: 72,449,716	M39I	probably damaging	Het
Ltbp2	A	T	12: 84,830,645	I402N	probably damaging	Het
Mst1	G	A	9: 108,082,549	G297D	probably damaging	Het
Muc6	G	C	7: 141,637,746	P2338R	probably damaging	Het
Nbr1	G	A	11: 101,566,200	R163Q	probably damaging	Het
Nlrp4f	A	G	13: 65,194,329	F501L	probably damaging	Het
Nup133	A	C	8: 123,922,414	I563S	probably benign	Het
Oacyl	T	G	18: 65,725,298		probably null	Het
Oog4	CAA	CA	4: 143,437,452		probably null	Het
Plxna2	C	T	1: 194,643,895	R46C	possibly damaging	Het
Ppp1r26	T	A	2: 28,450,737	D126E	probably damaging	Het
Prl6a1	A	T	13: 27,316,299	R84S	possibly damaging	Het
Ptprz1	C	T	6: 23,001,747	Q1279*	probably null	Het
Ptx4	C	T	17: 25,125,192	T472I	possibly damaging	Het
Rabgap1l	A	G	1: 160,700,788	V416A	probably damaging	Het
Rbfox2	A	T	15: 77,105,634	D231E	probably benign	Het
Reln	A	T	5: 22,227,638	F121L	possibly damaging	Het
Rfx7	G	A	9: 72,616,772	V415I	probably benign	Het
Scaf4	A	T	16: 90,230,076	M951K	unknown	Het
Sdf4	T	C	4: 155,996,520		probably null	Het
Sec16a	T	C	2: 26,441,851	T51A	probably damaging	Het
Sema3a	A	G	5: 13,557,041	N281S	probably damaging	Het
Snai2	G	A	16: 14,706,890	V87I	possibly damaging	Het
Synj2	T	A	17: 5,990,239	S197T	possibly damaging	Het
Tdrd12	A	G	7: 35,478,091	V946A	unknown	Het
Trat1	A	T	16: 48,754,294		probably null	Het
Vmn1r75	T	A	7: 11,881,070	I243K	possibly damaging	Het
Vmn2r83	G	A	10: 79,491,937	C793Y	probably damaging	Het
Wnt9a	G	A	11: 59,328,757	G203D	probably damaging	Het
Xrn2	T	C	2: 147,029,756	I366T	probably damaging	Het
Zfp280d	A	G	9: 72,361,942	D787G	possibly damaging	Het
Zfp706	T	C	15: 37,001,925	T53A	probably damaging	Het

Other mutations in Syt6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Syt6	APN	3	103625626	missense	probably damaging	0.98
IGL02944:Syt6	APN	3	103575549	unclassified	probably benign
IGL03168:Syt6	APN	3	103587627	missense	probably damaging	1.00
PIT4305001:Syt6	UTSW	3	103575453	missense	possibly damaging	0.91
R0124:Syt6	UTSW	3	103587526	missense	probably damaging	1.00
R0587:Syt6	UTSW	3	103625571	missense	probably damaging	0.99
R0601:Syt6	UTSW	3	103620890	missense	probably damaging	1.00
R1262:Syt6	UTSW	3	103585340	critical splice acceptor site	probably null
R1970:Syt6	UTSW	3	103587420	missense	probably benign	0.21
R4012:Syt6	UTSW	3	103625493	splice site	probably benign
R4450:Syt6	UTSW	3	103585645	missense	probably benign	0.01
R4493:Syt6	UTSW	3	103585630	missense	probably damaging	0.99
R4494:Syt6	UTSW	3	103585630	missense	probably damaging	0.99
R4495:Syt6	UTSW	3	103587560	nonsense	probably null
R4740:Syt6	UTSW	3	103625656	missense	probably damaging	1.00
R4750:Syt6	UTSW	3	103630917	makesense	probably null
R5668:Syt6	UTSW	3	103620901	missense	probably damaging	1.00
R6185:Syt6	UTSW	3	103585528	missense	probably damaging	1.00
R6660:Syt6	UTSW	3	103625644	missense	probably damaging	1.00
R7120:Syt6	UTSW	3	103587357	missense	probably damaging	1.00
R7307:Syt6	UTSW	3	103587472	missense	probably damaging	1.00
Z1177:Syt6	UTSW	3	103645115	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GCCAAGGACTTTTGCGGAAG -3'
(R):5'- GTTCCCTATGTACCTCTAGGGG -3'

Sequencing Primer
(F):5'- TTGCGGAAGTTCTGACCC -3'
(R):5'- TACCTCTAGGGGGACAGAGTGC -3'

Posted On

2019-10-17