Incidental Mutation 'R7501:Gfpt1'
ID581470
Institutional Source Beutler Lab
Gene Symbol Gfpt1
Ensembl Gene ENSMUSG00000029992
Gene Nameglutamine fructose-6-phosphate transaminase 1
SynonymsGFA, 2810423A18Rik, GFAT, GFAT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7501 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location87042846-87092197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87082526 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 510 (D510E)
Ref Sequence ENSEMBL: ENSMUSP00000032057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032057] [ENSMUST00000113658]
Predicted Effect probably benign
Transcript: ENSMUST00000032057
AA Change: D510E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032057
Gene: ENSMUSG00000029992
AA Change: D510E

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
Pfam:GATase_6 69 213 1e-18 PFAM
Pfam:GATase_4 78 198 2.7e-7 PFAM
Pfam:GATase_7 93 195 2.1e-14 PFAM
Pfam:SIS 378 507 4.5e-38 PFAM
Pfam:SIS 549 680 1.6e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113658
AA Change: D494E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109288
Gene: ENSMUSG00000029992
AA Change: D494E

DomainStartEndE-ValueType
Pfam:GATase_2 2 78 9e-9 PFAM
Pfam:GATase_4 63 191 3.2e-10 PFAM
Pfam:GATase_6 68 211 3.7e-20 PFAM
Pfam:GATase_2 76 220 6.4e-22 PFAM
Pfam:GATase_7 93 194 1.7e-15 PFAM
Pfam:SIS 362 491 4.5e-36 PFAM
Pfam:SIS 533 664 2.3e-31 PFAM
Meta Mutation Damage Score 0.0579 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the first and rate-limiting enzyme of the hexosamine pathway and controls the flux of glucose into the hexosamine pathway. The product of this gene catalyzes the formation of glucosamine 6-phosphate. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 A G 3: 36,088,825 N503S probably benign Het
Adam1a C T 5: 121,518,948 A761T possibly damaging Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Ankrd44 T C 1: 54,649,363 E238G Het
Ap3b2 A T 7: 81,473,446 I440K probably damaging Het
Atp2a1 G A 7: 126,450,172 T566I probably benign Het
B3galnt1 T C 3: 69,575,299 I210V probably benign Het
Bag5 T C 12: 111,710,288 K367R probably benign Het
Cdc25b T C 2: 131,194,160 Y410H probably damaging Het
Cgref1 G T 5: 30,945,456 P7Q probably damaging Het
Cnot6 T C 11: 49,685,332 I136V probably benign Het
Comp A G 8: 70,379,409 D500G possibly damaging Het
Dnah7b T C 1: 46,356,554 L3872P probably damaging Het
Dync2h1 A T 9: 7,175,336 L91Q possibly damaging Het
Fancd2 T C 6: 113,548,403 V280A possibly damaging Het
Fat4 T A 3: 38,958,448 Y2297* probably null Het
Fem1c A T 18: 46,505,801 M378K probably damaging Het
Gata6 A G 18: 11,054,082 T4A probably damaging Het
Gatb G C 3: 85,636,990 V422L probably damaging Het
Gm12394 T C 4: 42,791,357 E925G probably damaging Het
Gria4 A T 9: 4,502,436 Y366N probably benign Het
Gucy1b1 T C 3: 82,035,359 H492R probably damaging Het
Hecw2 T C 1: 53,913,872 probably null Het
Hist1h2be A G 13: 23,585,793 I55T possibly damaging Het
Hnrnph1 A C 11: 50,379,556 E62D probably benign Het
Itga2 A G 13: 114,875,559 V274A probably damaging Het
Kdm5d T A Y: 941,488 W1230R probably damaging Het
Lctl A T 9: 64,131,579 M317L probably benign Het
Lrp6 T C 6: 134,486,508 D570G probably damaging Het
Lrrc9 G T 12: 72,449,716 M39I probably damaging Het
Ltbp2 A T 12: 84,830,645 I402N probably damaging Het
Mst1 G A 9: 108,082,549 G297D probably damaging Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Nbr1 G A 11: 101,566,200 R163Q probably damaging Het
Nlrp4f A G 13: 65,194,329 F501L probably damaging Het
Nup133 A C 8: 123,922,414 I563S probably benign Het
Oacyl T G 18: 65,725,298 probably null Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna2 C T 1: 194,643,895 R46C possibly damaging Het
Ppp1r26 T A 2: 28,450,737 D126E probably damaging Het
Prl6a1 A T 13: 27,316,299 R84S possibly damaging Het
Ptprz1 C T 6: 23,001,747 Q1279* probably null Het
Ptx4 C T 17: 25,125,192 T472I possibly damaging Het
Rabgap1l A G 1: 160,700,788 V416A probably damaging Het
Rbfox2 A T 15: 77,105,634 D231E probably benign Het
Reln A T 5: 22,227,638 F121L possibly damaging Het
Rfx7 G A 9: 72,616,772 V415I probably benign Het
Scaf4 A T 16: 90,230,076 M951K unknown Het
Sdf4 T C 4: 155,996,520 probably null Het
Sec16a T C 2: 26,441,851 T51A probably damaging Het
Sema3a A G 5: 13,557,041 N281S probably damaging Het
Snai2 G A 16: 14,706,890 V87I possibly damaging Het
Synj2 T A 17: 5,990,239 S197T possibly damaging Het
Syt6 A T 3: 103,587,702 M328L probably benign Het
Tdrd12 A G 7: 35,478,091 V946A unknown Het
Trat1 A T 16: 48,754,294 probably null Het
Vmn1r75 T A 7: 11,881,070 I243K possibly damaging Het
Vmn2r83 G A 10: 79,491,937 C793Y probably damaging Het
Wnt9a G A 11: 59,328,757 G203D probably damaging Het
Xrn2 T C 2: 147,029,756 I366T probably damaging Het
Zfp280d A G 9: 72,361,942 D787G possibly damaging Het
Zfp706 T C 15: 37,001,925 T53A probably damaging Het
Other mutations in Gfpt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Gfpt1 APN 6 87056163 missense probably damaging 1.00
IGL00946:Gfpt1 APN 6 87050942 missense probably damaging 1.00
IGL01083:Gfpt1 APN 6 87054696 missense probably damaging 1.00
IGL01930:Gfpt1 APN 6 87059415 missense possibly damaging 0.88
IGL02113:Gfpt1 APN 6 87087367 missense probably benign 0.04
IGL02724:Gfpt1 APN 6 87056182 nonsense probably null
IGL03024:Gfpt1 APN 6 87053831 missense probably damaging 1.00
R0829:Gfpt1 UTSW 6 87053865 splice site probably benign
R1779:Gfpt1 UTSW 6 87077197 missense possibly damaging 0.74
R1982:Gfpt1 UTSW 6 87054630 missense possibly damaging 0.90
R2067:Gfpt1 UTSW 6 87057754 missense probably benign 0.02
R2400:Gfpt1 UTSW 6 87087348 missense probably damaging 1.00
R2438:Gfpt1 UTSW 6 87057745 missense probably null 1.00
R3104:Gfpt1 UTSW 6 87057646 missense probably benign 0.16
R3105:Gfpt1 UTSW 6 87057646 missense probably benign 0.16
R4738:Gfpt1 UTSW 6 87054747 intron probably benign
R5070:Gfpt1 UTSW 6 87053745 splice site probably null
R5292:Gfpt1 UTSW 6 87076255 critical splice acceptor site probably null
R5392:Gfpt1 UTSW 6 87077157 missense probably damaging 0.99
R5481:Gfpt1 UTSW 6 87050969 missense probably damaging 1.00
R5646:Gfpt1 UTSW 6 87042999 start codon destroyed probably null 0.92
R5666:Gfpt1 UTSW 6 87053813 missense possibly damaging 0.94
R6003:Gfpt1 UTSW 6 87088248 splice site probably null
R6031:Gfpt1 UTSW 6 87086320 missense probably damaging 1.00
R6031:Gfpt1 UTSW 6 87086320 missense probably damaging 1.00
R6045:Gfpt1 UTSW 6 87085257 missense probably damaging 1.00
R6341:Gfpt1 UTSW 6 87088145 missense probably damaging 1.00
R6980:Gfpt1 UTSW 6 87077089 missense probably damaging 1.00
R7120:Gfpt1 UTSW 6 87087393 missense probably benign 0.25
R7123:Gfpt1 UTSW 6 87056186 missense probably damaging 1.00
R7249:Gfpt1 UTSW 6 87056144 missense probably damaging 0.98
R7374:Gfpt1 UTSW 6 87050977 missense probably benign 0.00
R7502:Gfpt1 UTSW 6 87066689 missense probably benign 0.00
R8244:Gfpt1 UTSW 6 87063631 intron probably benign
Predicted Primers PCR Primer
(F):5'- CTCCAGAGTTATGTGTAAAAGATGAAT -3'
(R):5'- GCCCATGAAGTTTACACAGGGT -3'

Sequencing Primer
(F):5'- TAGCTGCTCTTATAAAGGACCCAGG -3'
(R):5'- TACATGTGCAAAGCCTTGGC -3'
Posted On2019-10-17