Incidental Mutation 'R7501:Tdrd12'
ID581475
Institutional Source Beutler Lab
Gene Symbol Tdrd12
Ensembl Gene ENSMUSG00000030491
Gene Nametudor domain containing 12
SynonymsEG434165, 2410070K17Rik, ecat8, 2410004F06Rik, G1-476-14, repro23
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R7501 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location35469098-35537745 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35478091 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 946 (V946A)
Ref Sequence ENSEMBL: ENSMUSP00000141796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000187190] [ENSMUST00000193633]
Predicted Effect
SMART Domains Protein: ENSMUSP00000140328
Gene: ENSMUSG00000030491
AA Change: V1007A

DomainStartEndE-ValueType
Pfam:TUDOR 1 129 5.1e-24 PFAM
Pfam:DEAD 276 581 1.8e-6 PFAM
Pfam:TUDOR 852 973 4.9e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000193633
AA Change: V946A
SMART Domains Protein: ENSMUSP00000141796
Gene: ENSMUSG00000030491
AA Change: V946A

DomainStartEndE-ValueType
Pfam:TUDOR 1 129 2.7e-24 PFAM
Pfam:DEAD 273 606 7.6e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Homozygous males are infertile with small testes. Spermatogenesis is arrested predominantly at the pachytene spermatocyte stage. Retrotransposon hopping is derepressed in germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 A G 3: 36,088,825 N503S probably benign Het
Adam1a C T 5: 121,518,948 A761T possibly damaging Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Ankrd44 T C 1: 54,649,363 E238G Het
Ap3b2 A T 7: 81,473,446 I440K probably damaging Het
Atp2a1 G A 7: 126,450,172 T566I probably benign Het
B3galnt1 T C 3: 69,575,299 I210V probably benign Het
Bag5 T C 12: 111,710,288 K367R probably benign Het
Cdc25b T C 2: 131,194,160 Y410H probably damaging Het
Cgref1 G T 5: 30,945,456 P7Q probably damaging Het
Cnot6 T C 11: 49,685,332 I136V probably benign Het
Comp A G 8: 70,379,409 D500G possibly damaging Het
Dnah7b T C 1: 46,356,554 L3872P probably damaging Het
Dync2h1 A T 9: 7,175,336 L91Q possibly damaging Het
Fancd2 T C 6: 113,548,403 V280A possibly damaging Het
Fat4 T A 3: 38,958,448 Y2297* probably null Het
Fem1c A T 18: 46,505,801 M378K probably damaging Het
Gata6 A G 18: 11,054,082 T4A probably damaging Het
Gatb G C 3: 85,636,990 V422L probably damaging Het
Gfpt1 T A 6: 87,082,526 D510E probably benign Het
Gm12394 T C 4: 42,791,357 E925G probably damaging Het
Gria4 A T 9: 4,502,436 Y366N probably benign Het
Gucy1b1 T C 3: 82,035,359 H492R probably damaging Het
Hecw2 T C 1: 53,913,872 probably null Het
Hist1h2be A G 13: 23,585,793 I55T possibly damaging Het
Hnrnph1 A C 11: 50,379,556 E62D probably benign Het
Itga2 A G 13: 114,875,559 V274A probably damaging Het
Kdm5d T A Y: 941,488 W1230R probably damaging Het
Lctl A T 9: 64,131,579 M317L probably benign Het
Lrp6 T C 6: 134,486,508 D570G probably damaging Het
Lrrc9 G T 12: 72,449,716 M39I probably damaging Het
Ltbp2 A T 12: 84,830,645 I402N probably damaging Het
Mst1 G A 9: 108,082,549 G297D probably damaging Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Nbr1 G A 11: 101,566,200 R163Q probably damaging Het
Nlrp4f A G 13: 65,194,329 F501L probably damaging Het
Nup133 A C 8: 123,922,414 I563S probably benign Het
Oacyl T G 18: 65,725,298 probably null Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna2 C T 1: 194,643,895 R46C possibly damaging Het
Ppp1r26 T A 2: 28,450,737 D126E probably damaging Het
Prl6a1 A T 13: 27,316,299 R84S possibly damaging Het
Ptprz1 C T 6: 23,001,747 Q1279* probably null Het
Ptx4 C T 17: 25,125,192 T472I possibly damaging Het
Rabgap1l A G 1: 160,700,788 V416A probably damaging Het
Rbfox2 A T 15: 77,105,634 D231E probably benign Het
Reln A T 5: 22,227,638 F121L possibly damaging Het
Rfx7 G A 9: 72,616,772 V415I probably benign Het
Scaf4 A T 16: 90,230,076 M951K unknown Het
Sdf4 T C 4: 155,996,520 probably null Het
Sec16a T C 2: 26,441,851 T51A probably damaging Het
Sema3a A G 5: 13,557,041 N281S probably damaging Het
Snai2 G A 16: 14,706,890 V87I possibly damaging Het
Synj2 T A 17: 5,990,239 S197T possibly damaging Het
Syt6 A T 3: 103,587,702 M328L probably benign Het
Trat1 A T 16: 48,754,294 probably null Het
Vmn1r75 T A 7: 11,881,070 I243K possibly damaging Het
Vmn2r83 G A 10: 79,491,937 C793Y probably damaging Het
Wnt9a G A 11: 59,328,757 G203D probably damaging Het
Xrn2 T C 2: 147,029,756 I366T probably damaging Het
Zfp280d A G 9: 72,361,942 D787G possibly damaging Het
Zfp706 T C 15: 37,001,925 T53A probably damaging Het
Other mutations in Tdrd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Tdrd12 APN 7 35505034 missense possibly damaging 0.95
IGL01879:Tdrd12 APN 7 35521923 missense probably damaging 1.00
IGL02026:Tdrd12 APN 7 35504233 splice site probably benign
IGL02186:Tdrd12 APN 7 35501401 missense probably damaging 0.99
PIT4131001:Tdrd12 UTSW 7 35481103 nonsense probably null
R0071:Tdrd12 UTSW 7 35529246 missense possibly damaging 0.92
R0071:Tdrd12 UTSW 7 35529246 missense possibly damaging 0.92
R0098:Tdrd12 UTSW 7 35475993 missense probably damaging 1.00
R0366:Tdrd12 UTSW 7 35508802 missense probably benign 0.25
R2050:Tdrd12 UTSW 7 35529247 missense probably damaging 0.98
R2851:Tdrd12 UTSW 7 35485373 missense probably damaging 1.00
R3715:Tdrd12 UTSW 7 35504980 missense probably benign 0.05
R3859:Tdrd12 UTSW 7 35493820 missense possibly damaging 0.50
R3912:Tdrd12 UTSW 7 35487713 missense probably damaging 1.00
R4656:Tdrd12 UTSW 7 35485254 missense probably damaging 1.00
R4826:Tdrd12 UTSW 7 35504157 missense probably benign 0.00
R4969:Tdrd12 UTSW 7 35487295 splice site probably null
R5202:Tdrd12 UTSW 7 35490030 missense possibly damaging 0.49
R5321:Tdrd12 UTSW 7 35478094 missense probably damaging 1.00
R5642:Tdrd12 UTSW 7 35511300 missense probably damaging 0.99
R5709:Tdrd12 UTSW 7 35476053 missense probably damaging 1.00
R5835:Tdrd12 UTSW 7 35529264 missense probably damaging 1.00
R6029:Tdrd12 UTSW 7 35485230 missense probably damaging 0.98
R6101:Tdrd12 UTSW 7 35481133 nonsense probably null
R6341:Tdrd12 UTSW 7 35490048 missense probably damaging 1.00
R6631:Tdrd12 UTSW 7 35485229 missense probably damaging 0.99
R6939:Tdrd12 UTSW 7 35485599 critical splice donor site probably null
R7032:Tdrd12 UTSW 7 35481046 nonsense probably null
R7058:Tdrd12 UTSW 7 35478109 missense unknown
R7096:Tdrd12 UTSW 7 35487589 missense
R7203:Tdrd12 UTSW 7 35489223 nonsense probably null
R7229:Tdrd12 UTSW 7 35480280 missense unknown
R7265:Tdrd12 UTSW 7 35487722 missense
R7284:Tdrd12 UTSW 7 35480136 splice site probably null
R7347:Tdrd12 UTSW 7 35485692 missense
R7789:Tdrd12 UTSW 7 35488692 missense
R8374:Tdrd12 UTSW 7 35478061 missense unknown
R8379:Tdrd12 UTSW 7 35524057 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCACATGCACTGTCACCATG -3'
(R):5'- CTGACTCAGAGAGCTGTATGG -3'

Sequencing Primer
(F):5'- GTCTCACCACACAAAAACAAAAC -3'
(R):5'- TATGGGAAGCAGAGGCATTATGTTC -3'
Posted On2019-10-17