Mutagenetix > Incidental Mutations

Incidental Mutation 'R7501:Ap3b2'

581476

Institutional Source

Beutler Lab

Gene Symbol

Ap3b2

Ensembl Gene

ENSMUSG00000062444

Gene Name

adaptor-related protein complex 3, beta 2 subunit

Synonyms

beta3B, Naptb

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.117) question?

Stock #

R7501 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

81460399-81493925 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 81473446 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 440 (I440K)

Ref Sequence

ENSEMBL: ENSMUSP00000080739 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]

Predicted Effect

probably damaging
Transcript: ENSMUST00000082090
AA Change: I440K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: I440K

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	34	590	8.2e-182	PFAM
low complexity region	689	782	N/A	INTRINSIC
AP3B1_C	801	947	4.58e-75	SMART
Blast:B2	971	1080	2e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000152355

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad9	A	G	3: 36,088,825	N503S	probably benign	Het
Adam1a	C	T	5: 121,518,948	A761T	possibly damaging	Het
Amn1	C	T	6: 149,185,031	M44I	probably benign	Het
Ankrd44	T	C	1: 54,649,363	E238G		Het
Atp2a1	G	A	7: 126,450,172	T566I	probably benign	Het
B3galnt1	T	C	3: 69,575,299	I210V	probably benign	Het
Bag5	T	C	12: 111,710,288	K367R	probably benign	Het
Cdc25b	T	C	2: 131,194,160	Y410H	probably damaging	Het
Cgref1	G	T	5: 30,945,456	P7Q	probably damaging	Het
Cnot6	T	C	11: 49,685,332	I136V	probably benign	Het
Comp	A	G	8: 70,379,409	D500G	possibly damaging	Het
Dnah7b	T	C	1: 46,356,554	L3872P	probably damaging	Het
Dync2h1	A	T	9: 7,175,336	L91Q	possibly damaging	Het
Fancd2	T	C	6: 113,548,403	V280A	possibly damaging	Het
Fat4	T	A	3: 38,958,448	Y2297*	probably null	Het
Fem1c	A	T	18: 46,505,801	M378K	probably damaging	Het
Gata6	A	G	18: 11,054,082	T4A	probably damaging	Het
Gatb	G	C	3: 85,636,990	V422L	probably damaging	Het
Gfpt1	T	A	6: 87,082,526	D510E	probably benign	Het
Gm12394	T	C	4: 42,791,357	E925G	probably damaging	Het
Gria4	A	T	9: 4,502,436	Y366N	probably benign	Het
Gucy1b1	T	C	3: 82,035,359	H492R	probably damaging	Het
Hecw2	T	C	1: 53,913,872		probably null	Het
Hist1h2be	A	G	13: 23,585,793	I55T	possibly damaging	Het
Hnrnph1	A	C	11: 50,379,556	E62D	probably benign	Het
Itga2	A	G	13: 114,875,559	V274A	probably damaging	Het
Kdm5d	T	A	Y: 941,488	W1230R	probably damaging	Het
Lctl	A	T	9: 64,131,579	M317L	probably benign	Het
Lrp6	T	C	6: 134,486,508	D570G	probably damaging	Het
Lrrc9	G	T	12: 72,449,716	M39I	probably damaging	Het
Ltbp2	A	T	12: 84,830,645	I402N	probably damaging	Het
Mst1	G	A	9: 108,082,549	G297D	probably damaging	Het
Muc6	G	C	7: 141,637,746	P2338R	probably damaging	Het
Nbr1	G	A	11: 101,566,200	R163Q	probably damaging	Het
Nlrp4f	A	G	13: 65,194,329	F501L	probably damaging	Het
Nup133	A	C	8: 123,922,414	I563S	probably benign	Het
Oacyl	T	G	18: 65,725,298		probably null	Het
Oog4	CAA	CA	4: 143,437,452		probably null	Het
Plxna2	C	T	1: 194,643,895	R46C	possibly damaging	Het
Ppp1r26	T	A	2: 28,450,737	D126E	probably damaging	Het
Prl6a1	A	T	13: 27,316,299	R84S	possibly damaging	Het
Ptprz1	C	T	6: 23,001,747	Q1279*	probably null	Het
Ptx4	C	T	17: 25,125,192	T472I	possibly damaging	Het
Rabgap1l	A	G	1: 160,700,788	V416A	probably damaging	Het
Rbfox2	A	T	15: 77,105,634	D231E	probably benign	Het
Reln	A	T	5: 22,227,638	F121L	possibly damaging	Het
Rfx7	G	A	9: 72,616,772	V415I	probably benign	Het
Scaf4	A	T	16: 90,230,076	M951K	unknown	Het
Sdf4	T	C	4: 155,996,520		probably null	Het
Sec16a	T	C	2: 26,441,851	T51A	probably damaging	Het
Sema3a	A	G	5: 13,557,041	N281S	probably damaging	Het
Snai2	G	A	16: 14,706,890	V87I	possibly damaging	Het
Synj2	T	A	17: 5,990,239	S197T	possibly damaging	Het
Syt6	A	T	3: 103,587,702	M328L	probably benign	Het
Tdrd12	A	G	7: 35,478,091	V946A	unknown	Het
Trat1	A	T	16: 48,754,294		probably null	Het
Vmn1r75	T	A	7: 11,881,070	I243K	possibly damaging	Het
Vmn2r83	G	A	10: 79,491,937	C793Y	probably damaging	Het
Wnt9a	G	A	11: 59,328,757	G203D	probably damaging	Het
Xrn2	T	C	2: 147,029,756	I366T	probably damaging	Het
Zfp280d	A	G	9: 72,361,942	D787G	possibly damaging	Het
Zfp706	T	C	15: 37,001,925	T53A	probably damaging	Het

Other mutations in Ap3b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00772:Ap3b2	APN	7	81471949	missense	probably damaging	0.98
IGL01695:Ap3b2	APN	7	81476939	splice site	probably benign
IGL01876:Ap3b2	APN	7	81473854	splice site	probably null
IGL02132:Ap3b2	APN	7	81460998	missense	unknown
IGL02227:Ap3b2	APN	7	81473404	missense	probably damaging	1.00
IGL02660:Ap3b2	APN	7	81465698	missense	probably benign	0.13
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0142:Ap3b2	UTSW	7	81473080	missense	probably damaging	0.96
R0317:Ap3b2	UTSW	7	81463681	splice site	probably null
R0568:Ap3b2	UTSW	7	81464629	critical splice donor site	probably null
R1035:Ap3b2	UTSW	7	81463911	missense	unknown
R1121:Ap3b2	UTSW	7	81464195	missense	unknown
R1160:Ap3b2	UTSW	7	81466169	critical splice donor site	probably null
R1489:Ap3b2	UTSW	7	81463690	nonsense	probably null
R1542:Ap3b2	UTSW	7	81478077	splice site	probably null
R1652:Ap3b2	UTSW	7	81473399	missense	probably damaging	1.00
R1741:Ap3b2	UTSW	7	81467599	missense	possibly damaging	0.95
R1872:Ap3b2	UTSW	7	81464150	missense	unknown
R2065:Ap3b2	UTSW	7	81463774	missense	unknown
R2353:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2354:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2398:Ap3b2	UTSW	7	81477195	missense	probably damaging	0.99
R3421:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3710:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3932:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3933:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R4152:Ap3b2	UTSW	7	81478017	missense	probably damaging	1.00
R4209:Ap3b2	UTSW	7	81477136	missense	probably benign	0.02
R4732:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4733:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4841:Ap3b2	UTSW	7	81477930	missense	probably damaging	1.00
R5207:Ap3b2	UTSW	7	81476769	missense	possibly damaging	0.48
R5659:Ap3b2	UTSW	7	81476752	missense	probably damaging	0.98
R6109:Ap3b2	UTSW	7	81493592	missense	possibly damaging	0.55
R6223:Ap3b2	UTSW	7	81473462	nonsense	probably null
R6901:Ap3b2	UTSW	7	81484912	critical splice acceptor site	probably null
R6981:Ap3b2	UTSW	7	81477993	missense	probably damaging	1.00
R7061:Ap3b2	UTSW	7	81461009	missense	unknown
R7317:Ap3b2	UTSW	7	81461028	missense	unknown
R7543:Ap3b2	UTSW	7	81466146	intron	probably null
R7643:Ap3b2	UTSW	7	81477072	missense	probably benign	0.24
R7707:Ap3b2	UTSW	7	81476782	missense	possibly damaging	0.60
X0013:Ap3b2	UTSW	7	81463240	critical splice donor site	probably null
X0028:Ap3b2	UTSW	7	81463764	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CAGCTCAGTTACAGCAATACCTG -3'
(R):5'- GGCATGATGAGTTGTCATACGG -3'

Sequencing Primer
(F):5'- TGCACACTAACTGAAGCAGATAG -3'
(R):5'- ATGATGAGTTGTCATACGGAGGTTTG -3'

Posted On

2019-10-17