Incidental Mutation 'R7501:Comp'
ID581479
Institutional Source Beutler Lab
Gene Symbol Comp
Ensembl Gene ENSMUSG00000031849
Gene Namecartilage oligomeric matrix protein
Synonymsthrombospondin-5, TSP5
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R7501 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70373558-70382066 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70379409 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 500 (D500G)
Ref Sequence ENSEMBL: ENSMUSP00000003659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003659] [ENSMUST00000076615]
PDB Structure
Storage function of COMP:the crystal structure of the coiled-coil domain in complex with vitamin D3 [X-RAY DIFFRACTION]
COMPcc in complex with fatty acids [X-RAY DIFFRACTION]
COMPcc in complex with fatty acids [X-RAY DIFFRACTION]
COMPcc in complex with fatty acids [X-RAY DIFFRACTION]
COMPcc in complex with fatty acids [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003659
AA Change: D500G

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000003659
Gene: ENSMUSG00000031849
AA Change: D500G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:COMP 28 72 6.2e-22 PFAM
EGF 88 124 8.19e-2 SMART
EGF_CA 125 177 5.08e-7 SMART
EGF_CA 178 220 1.73e-9 SMART
EGF 226 265 7.53e-1 SMART
Pfam:TSP_3 299 334 6.1e-16 PFAM
Pfam:TSP_3 358 393 1.2e-15 PFAM
Pfam:TSP_3 393 416 2.7e-6 PFAM
Pfam:TSP_3 417 454 1.6e-14 PFAM
Pfam:TSP_3 455 490 3.7e-14 PFAM
Pfam:TSP_3 491 526 6.1e-15 PFAM
Pfam:TSP_C 544 741 2.6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076615
SMART Domains Protein: ENSMUSP00000075916
Gene: ENSMUSG00000003575

DomainStartEndE-ValueType
Pfam:TORC_N 6 66 1.1e-26 PFAM
Pfam:TORC_M 148 289 4.8e-64 PFAM
low complexity region 359 394 N/A INTRINSIC
Pfam:TORC_C 555 630 9.2e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212488
Predicted Effect probably benign
Transcript: ENSMUST00000213072
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a noncollagenous extracellular matrix (ECM) protein. It consists of five identical glycoprotein subunits, each with EGF-like and calcium-binding (thrombospondin-like) domains. Oligomerization results from formation of a five-stranded coiled coil and disulfides. Binding to other ECM proteins such as collagen appears to depend on divalent cations. Contraction or expansion of a 5 aa aspartate repeat and other mutations can cause pseudochondroplasia (PSACH) and multiple epiphyseal dysplasia (MED). [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation are indistinguishable from controls. Mice homozygous for a knockin allele with two point mutations exhibit short limb dwarfism, osteoarthritis, abnormal chondrocytes, mild myopathy, and abnormal tendon morphology and stiffness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 A G 3: 36,088,825 N503S probably benign Het
Adam1a C T 5: 121,518,948 A761T possibly damaging Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Ankrd44 T C 1: 54,649,363 E238G Het
Ap3b2 A T 7: 81,473,446 I440K probably damaging Het
Atp2a1 G A 7: 126,450,172 T566I probably benign Het
B3galnt1 T C 3: 69,575,299 I210V probably benign Het
Bag5 T C 12: 111,710,288 K367R probably benign Het
Cdc25b T C 2: 131,194,160 Y410H probably damaging Het
Cgref1 G T 5: 30,945,456 P7Q probably damaging Het
Cnot6 T C 11: 49,685,332 I136V probably benign Het
Dnah7b T C 1: 46,356,554 L3872P probably damaging Het
Dync2h1 A T 9: 7,175,336 L91Q possibly damaging Het
Fancd2 T C 6: 113,548,403 V280A possibly damaging Het
Fat4 T A 3: 38,958,448 Y2297* probably null Het
Fem1c A T 18: 46,505,801 M378K probably damaging Het
Gata6 A G 18: 11,054,082 T4A probably damaging Het
Gatb G C 3: 85,636,990 V422L probably damaging Het
Gfpt1 T A 6: 87,082,526 D510E probably benign Het
Gm12394 T C 4: 42,791,357 E925G probably damaging Het
Gria4 A T 9: 4,502,436 Y366N probably benign Het
Gucy1b1 T C 3: 82,035,359 H492R probably damaging Het
Hecw2 T C 1: 53,913,872 probably null Het
Hist1h2be A G 13: 23,585,793 I55T possibly damaging Het
Hnrnph1 A C 11: 50,379,556 E62D probably benign Het
Itga2 A G 13: 114,875,559 V274A probably damaging Het
Kdm5d T A Y: 941,488 W1230R probably damaging Het
Lctl A T 9: 64,131,579 M317L probably benign Het
Lrp6 T C 6: 134,486,508 D570G probably damaging Het
Lrrc9 G T 12: 72,449,716 M39I probably damaging Het
Ltbp2 A T 12: 84,830,645 I402N probably damaging Het
Mst1 G A 9: 108,082,549 G297D probably damaging Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Nbr1 G A 11: 101,566,200 R163Q probably damaging Het
Nlrp4f A G 13: 65,194,329 F501L probably damaging Het
Nup133 A C 8: 123,922,414 I563S probably benign Het
Oacyl T G 18: 65,725,298 probably null Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna2 C T 1: 194,643,895 R46C possibly damaging Het
Ppp1r26 T A 2: 28,450,737 D126E probably damaging Het
Prl6a1 A T 13: 27,316,299 R84S possibly damaging Het
Ptprz1 C T 6: 23,001,747 Q1279* probably null Het
Ptx4 C T 17: 25,125,192 T472I possibly damaging Het
Rabgap1l A G 1: 160,700,788 V416A probably damaging Het
Rbfox2 A T 15: 77,105,634 D231E probably benign Het
Reln A T 5: 22,227,638 F121L possibly damaging Het
Rfx7 G A 9: 72,616,772 V415I probably benign Het
Scaf4 A T 16: 90,230,076 M951K unknown Het
Sdf4 T C 4: 155,996,520 probably null Het
Sec16a T C 2: 26,441,851 T51A probably damaging Het
Sema3a A G 5: 13,557,041 N281S probably damaging Het
Snai2 G A 16: 14,706,890 V87I possibly damaging Het
Synj2 T A 17: 5,990,239 S197T possibly damaging Het
Syt6 A T 3: 103,587,702 M328L probably benign Het
Tdrd12 A G 7: 35,478,091 V946A unknown Het
Trat1 A T 16: 48,754,294 probably null Het
Vmn1r75 T A 7: 11,881,070 I243K possibly damaging Het
Vmn2r83 G A 10: 79,491,937 C793Y probably damaging Het
Wnt9a G A 11: 59,328,757 G203D probably damaging Het
Xrn2 T C 2: 147,029,756 I366T probably damaging Het
Zfp280d A G 9: 72,361,942 D787G possibly damaging Het
Zfp706 T C 15: 37,001,925 T53A probably damaging Het
Other mutations in Comp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Comp APN 8 70378635 missense probably damaging 1.00
IGL02110:Comp APN 8 70373639 missense probably benign 0.08
IGL02721:Comp APN 8 70376081 missense probably damaging 1.00
IGL02812:Comp APN 8 70376687 missense possibly damaging 0.75
IGL03023:Comp APN 8 70378610 unclassified probably benign
BB007:Comp UTSW 8 70373853 missense probably damaging 1.00
BB017:Comp UTSW 8 70373853 missense probably damaging 1.00
IGL03047:Comp UTSW 8 70374909 missense possibly damaging 0.65
R0217:Comp UTSW 8 70378908 missense probably damaging 1.00
R0503:Comp UTSW 8 70375734 missense possibly damaging 0.58
R0659:Comp UTSW 8 70379101 missense possibly damaging 0.84
R1490:Comp UTSW 8 70373913 missense possibly damaging 0.63
R1663:Comp UTSW 8 70373600 missense possibly damaging 0.93
R1666:Comp UTSW 8 70378957 splice site probably null
R1668:Comp UTSW 8 70378957 splice site probably null
R1789:Comp UTSW 8 70377146 missense probably benign 0.01
R2096:Comp UTSW 8 70376063 missense probably damaging 1.00
R2157:Comp UTSW 8 70379570 nonsense probably null
R3836:Comp UTSW 8 70373859 missense probably benign 0.26
R4630:Comp UTSW 8 70374382 missense possibly damaging 0.94
R4743:Comp UTSW 8 70376061 missense probably damaging 1.00
R4747:Comp UTSW 8 70376702 missense probably damaging 1.00
R5028:Comp UTSW 8 70376640 missense probably damaging 0.99
R5070:Comp UTSW 8 70376495 missense probably benign 0.25
R5083:Comp UTSW 8 70381300 missense probably damaging 1.00
R5917:Comp UTSW 8 70376361 splice site probably null
R6705:Comp UTSW 8 70376737 missense probably damaging 0.98
R6965:Comp UTSW 8 70376514 missense probably damaging 1.00
R7309:Comp UTSW 8 70373678 splice site probably null
R7402:Comp UTSW 8 70377204 missense probably benign 0.01
R7541:Comp UTSW 8 70381350 missense probably damaging 1.00
R7568:Comp UTSW 8 70373859 missense probably benign 0.26
R7930:Comp UTSW 8 70373853 missense probably damaging 1.00
R8103:Comp UTSW 8 70381286 missense probably damaging 1.00
R8259:Comp UTSW 8 70379054 missense probably damaging 1.00
R8271:Comp UTSW 8 70376460 missense probably damaging 1.00
Z1177:Comp UTSW 8 70377221 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCCTGTGATGACGATGATGAC -3'
(R):5'- CTAGCCACACCTGATTGAGC -3'

Sequencing Primer
(F):5'- TCCTGATAGCCGGGACAACTG -3'
(R):5'- TGATTGAGCACCACCCAGTTG -3'
Posted On2019-10-17