Incidental Mutation 'R7501:Nup133'
ID581480
Institutional Source Beutler Lab
Gene Symbol Nup133
Ensembl Gene ENSMUSG00000039509
Gene Namenucleoporin 133
Synonymsmermaid, 4832420O05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7501 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location123897123-123949265 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 123922414 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 563 (I563S)
Ref Sequence ENSEMBL: ENSMUSP00000048084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044795] [ENSMUST00000127664]
Predicted Effect probably benign
Transcript: ENSMUST00000044795
AA Change: I563S

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000048084
Gene: ENSMUSG00000039509
AA Change: I563S

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
PDB:1XKS|A 66 513 N/A PDB
Pfam:Nucleoporin_C 593 1052 1.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. The nucleoporin protein encoded by this gene displays evolutionarily conserved interactions with other nucleoporins. This protein, which localizes to both sides of the nuclear pore complex at interphase, remains associated with the complex during mitosis and is targeted at early stages to the reforming nuclear envelope. This protein also localizes to kinetochores of mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality prior to E10.5, abnormal somitogenesis, pericardial edema, growth retardation, and abnormal neural development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 A G 3: 36,088,825 N503S probably benign Het
Adam1a C T 5: 121,518,948 A761T possibly damaging Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Ankrd44 T C 1: 54,649,363 E238G Het
Ap3b2 A T 7: 81,473,446 I440K probably damaging Het
Atp2a1 G A 7: 126,450,172 T566I probably benign Het
B3galnt1 T C 3: 69,575,299 I210V probably benign Het
Bag5 T C 12: 111,710,288 K367R probably benign Het
Cdc25b T C 2: 131,194,160 Y410H probably damaging Het
Cgref1 G T 5: 30,945,456 P7Q probably damaging Het
Cnot6 T C 11: 49,685,332 I136V probably benign Het
Comp A G 8: 70,379,409 D500G possibly damaging Het
Dnah7b T C 1: 46,356,554 L3872P probably damaging Het
Dync2h1 A T 9: 7,175,336 L91Q possibly damaging Het
Fancd2 T C 6: 113,548,403 V280A possibly damaging Het
Fat4 T A 3: 38,958,448 Y2297* probably null Het
Fem1c A T 18: 46,505,801 M378K probably damaging Het
Gata6 A G 18: 11,054,082 T4A probably damaging Het
Gatb G C 3: 85,636,990 V422L probably damaging Het
Gfpt1 T A 6: 87,082,526 D510E probably benign Het
Gm12394 T C 4: 42,791,357 E925G probably damaging Het
Gria4 A T 9: 4,502,436 Y366N probably benign Het
Gucy1b1 T C 3: 82,035,359 H492R probably damaging Het
Hecw2 T C 1: 53,913,872 probably null Het
Hist1h2be A G 13: 23,585,793 I55T possibly damaging Het
Hnrnph1 A C 11: 50,379,556 E62D probably benign Het
Itga2 A G 13: 114,875,559 V274A probably damaging Het
Kdm5d T A Y: 941,488 W1230R probably damaging Het
Lctl A T 9: 64,131,579 M317L probably benign Het
Lrp6 T C 6: 134,486,508 D570G probably damaging Het
Lrrc9 G T 12: 72,449,716 M39I probably damaging Het
Ltbp2 A T 12: 84,830,645 I402N probably damaging Het
Mst1 G A 9: 108,082,549 G297D probably damaging Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Nbr1 G A 11: 101,566,200 R163Q probably damaging Het
Nlrp4f A G 13: 65,194,329 F501L probably damaging Het
Oacyl T G 18: 65,725,298 probably null Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna2 C T 1: 194,643,895 R46C possibly damaging Het
Ppp1r26 T A 2: 28,450,737 D126E probably damaging Het
Prl6a1 A T 13: 27,316,299 R84S possibly damaging Het
Ptprz1 C T 6: 23,001,747 Q1279* probably null Het
Ptx4 C T 17: 25,125,192 T472I possibly damaging Het
Rabgap1l A G 1: 160,700,788 V416A probably damaging Het
Rbfox2 A T 15: 77,105,634 D231E probably benign Het
Reln A T 5: 22,227,638 F121L possibly damaging Het
Rfx7 G A 9: 72,616,772 V415I probably benign Het
Scaf4 A T 16: 90,230,076 M951K unknown Het
Sdf4 T C 4: 155,996,520 probably null Het
Sec16a T C 2: 26,441,851 T51A probably damaging Het
Sema3a A G 5: 13,557,041 N281S probably damaging Het
Snai2 G A 16: 14,706,890 V87I possibly damaging Het
Synj2 T A 17: 5,990,239 S197T possibly damaging Het
Syt6 A T 3: 103,587,702 M328L probably benign Het
Tdrd12 A G 7: 35,478,091 V946A unknown Het
Trat1 A T 16: 48,754,294 probably null Het
Vmn1r75 T A 7: 11,881,070 I243K possibly damaging Het
Vmn2r83 G A 10: 79,491,937 C793Y probably damaging Het
Wnt9a G A 11: 59,328,757 G203D probably damaging Het
Xrn2 T C 2: 147,029,756 I366T probably damaging Het
Zfp280d A G 9: 72,361,942 D787G possibly damaging Het
Zfp706 T C 15: 37,001,925 T53A probably damaging Het
Other mutations in Nup133
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Nup133 APN 8 123939083 missense probably damaging 0.98
IGL00507:Nup133 APN 8 123918967 nonsense probably null
IGL00585:Nup133 APN 8 123909994 missense probably damaging 1.00
IGL00676:Nup133 APN 8 123906298 intron probably benign
IGL00966:Nup133 APN 8 123911906 missense probably damaging 0.98
IGL01069:Nup133 APN 8 123930982 nonsense probably null
IGL01553:Nup133 APN 8 123915324 missense possibly damaging 0.58
IGL01669:Nup133 APN 8 123939130 nonsense probably null
IGL01730:Nup133 APN 8 123938233 missense probably benign 0.00
IGL01996:Nup133 APN 8 123946595 missense probably benign 0.00
IGL02332:Nup133 APN 8 123907832 missense probably damaging 1.00
IGL02552:Nup133 APN 8 123929255 missense possibly damaging 0.75
IGL02956:Nup133 APN 8 123949083 missense probably benign 0.00
IGL03009:Nup133 APN 8 123933500 missense possibly damaging 0.46
IGL03036:Nup133 APN 8 123946594 missense probably benign 0.11
Slant UTSW 8 123916281 splice site probably null
R0010:Nup133 UTSW 8 123904579 missense probably damaging 1.00
R0010:Nup133 UTSW 8 123904579 missense probably damaging 1.00
R0139:Nup133 UTSW 8 123929343 missense probably benign 0.00
R0344:Nup133 UTSW 8 123917446 missense possibly damaging 0.82
R0730:Nup133 UTSW 8 123949008 missense probably benign 0.00
R1301:Nup133 UTSW 8 123917417 intron probably benign
R1453:Nup133 UTSW 8 123915375 missense probably benign 0.00
R1570:Nup133 UTSW 8 123949176 start codon destroyed possibly damaging 0.82
R1607:Nup133 UTSW 8 123949035 missense probably benign 0.02
R1773:Nup133 UTSW 8 123930983 nonsense probably null
R1992:Nup133 UTSW 8 123906221 missense possibly damaging 0.80
R2062:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2065:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2066:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2068:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R4397:Nup133 UTSW 8 123944301 missense probably benign 0.04
R4683:Nup133 UTSW 8 123930982 nonsense probably null
R4771:Nup133 UTSW 8 123929398 missense probably damaging 1.00
R4910:Nup133 UTSW 8 123927131 missense possibly damaging 0.91
R4911:Nup133 UTSW 8 123927131 missense possibly damaging 0.91
R4968:Nup133 UTSW 8 123915196 missense probably benign 0.07
R5411:Nup133 UTSW 8 123927206 missense probably benign
R5470:Nup133 UTSW 8 123930966 missense probably benign 0.00
R5664:Nup133 UTSW 8 123906281 missense probably benign 0.01
R5907:Nup133 UTSW 8 123916299 missense possibly damaging 0.90
R6003:Nup133 UTSW 8 123938292 missense probably damaging 0.98
R6059:Nup133 UTSW 8 123914596 missense probably damaging 1.00
R6219:Nup133 UTSW 8 123936873 missense possibly damaging 0.90
R6292:Nup133 UTSW 8 123917437 missense probably benign 0.01
R6672:Nup133 UTSW 8 123916281 splice site probably null
R6737:Nup133 UTSW 8 123906291 missense probably damaging 0.99
R6763:Nup133 UTSW 8 123944278 missense possibly damaging 0.95
R6870:Nup133 UTSW 8 123899507 missense probably benign 0.08
R6975:Nup133 UTSW 8 123915318 missense probably damaging 0.99
R7101:Nup133 UTSW 8 123906227 missense possibly damaging 0.89
R7114:Nup133 UTSW 8 123915373 missense probably benign 0.00
R7271:Nup133 UTSW 8 123922414 missense probably benign 0.34
R8054:Nup133 UTSW 8 123949217 intron probably benign
R8397:Nup133 UTSW 8 123922417 missense probably benign 0.17
X0023:Nup133 UTSW 8 123909988 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTACCTTTAACTGCTTGAGACAC -3'
(R):5'- ACAGACCTTTGGACTGAAGCG -3'

Sequencing Primer
(F):5'- CTAAAAGTGTGCGGAGTGGTCAC -3'
(R):5'- AGACCTTTGGACTGAAGCGTGTAC -3'
Posted On2019-10-17