Incidental Mutation 'R7501:Gria4'
ID581481
Institutional Source Beutler Lab
Gene Symbol Gria4
Ensembl Gene ENSMUSG00000025892
Gene Nameglutamate receptor, ionotropic, AMPA4 (alpha 4)
SynonymsGluralpha4, spkw1, Glur4, Glur-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.524) question?
Stock #R7501 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location4417896-4796234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4502436 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 366 (Y366N)
Ref Sequence ENSEMBL: ENSMUSP00000066980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000163309] [ENSMUST00000212533]
Predicted Effect probably benign
Transcript: ENSMUST00000027020
AA Change: Y366N

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: Y366N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 3e-61 PFAM
PBPe 416 791 8.23e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063508
AA Change: Y366N

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: Y366N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 2.5e-71 PFAM
PBPe 416 791 2.06e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163309
AA Change: Y366N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129316
Gene: ENSMUSG00000025892
AA Change: Y366N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 3.2e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212533
AA Change: Y366N

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 A G 3: 36,088,825 N503S probably benign Het
Adam1a C T 5: 121,518,948 A761T possibly damaging Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Ankrd44 T C 1: 54,649,363 E238G Het
Ap3b2 A T 7: 81,473,446 I440K probably damaging Het
Atp2a1 G A 7: 126,450,172 T566I probably benign Het
B3galnt1 T C 3: 69,575,299 I210V probably benign Het
Bag5 T C 12: 111,710,288 K367R probably benign Het
Cdc25b T C 2: 131,194,160 Y410H probably damaging Het
Cgref1 G T 5: 30,945,456 P7Q probably damaging Het
Cnot6 T C 11: 49,685,332 I136V probably benign Het
Comp A G 8: 70,379,409 D500G possibly damaging Het
Dnah7b T C 1: 46,356,554 L3872P probably damaging Het
Dync2h1 A T 9: 7,175,336 L91Q possibly damaging Het
Fancd2 T C 6: 113,548,403 V280A possibly damaging Het
Fat4 T A 3: 38,958,448 Y2297* probably null Het
Fem1c A T 18: 46,505,801 M378K probably damaging Het
Gata6 A G 18: 11,054,082 T4A probably damaging Het
Gatb G C 3: 85,636,990 V422L probably damaging Het
Gfpt1 T A 6: 87,082,526 D510E probably benign Het
Gm12394 T C 4: 42,791,357 E925G probably damaging Het
Gucy1b1 T C 3: 82,035,359 H492R probably damaging Het
Hecw2 T C 1: 53,913,872 probably null Het
Hist1h2be A G 13: 23,585,793 I55T possibly damaging Het
Hnrnph1 A C 11: 50,379,556 E62D probably benign Het
Itga2 A G 13: 114,875,559 V274A probably damaging Het
Kdm5d T A Y: 941,488 W1230R probably damaging Het
Lctl A T 9: 64,131,579 M317L probably benign Het
Lrp6 T C 6: 134,486,508 D570G probably damaging Het
Lrrc9 G T 12: 72,449,716 M39I probably damaging Het
Ltbp2 A T 12: 84,830,645 I402N probably damaging Het
Mst1 G A 9: 108,082,549 G297D probably damaging Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Nbr1 G A 11: 101,566,200 R163Q probably damaging Het
Nlrp4f A G 13: 65,194,329 F501L probably damaging Het
Nup133 A C 8: 123,922,414 I563S probably benign Het
Oacyl T G 18: 65,725,298 probably null Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna2 C T 1: 194,643,895 R46C possibly damaging Het
Ppp1r26 T A 2: 28,450,737 D126E probably damaging Het
Prl6a1 A T 13: 27,316,299 R84S possibly damaging Het
Ptprz1 C T 6: 23,001,747 Q1279* probably null Het
Ptx4 C T 17: 25,125,192 T472I possibly damaging Het
Rabgap1l A G 1: 160,700,788 V416A probably damaging Het
Rbfox2 A T 15: 77,105,634 D231E probably benign Het
Reln A T 5: 22,227,638 F121L possibly damaging Het
Rfx7 G A 9: 72,616,772 V415I probably benign Het
Scaf4 A T 16: 90,230,076 M951K unknown Het
Sdf4 T C 4: 155,996,520 probably null Het
Sec16a T C 2: 26,441,851 T51A probably damaging Het
Sema3a A G 5: 13,557,041 N281S probably damaging Het
Snai2 G A 16: 14,706,890 V87I possibly damaging Het
Synj2 T A 17: 5,990,239 S197T possibly damaging Het
Syt6 A T 3: 103,587,702 M328L probably benign Het
Tdrd12 A G 7: 35,478,091 V946A unknown Het
Trat1 A T 16: 48,754,294 probably null Het
Vmn1r75 T A 7: 11,881,070 I243K possibly damaging Het
Vmn2r83 G A 10: 79,491,937 C793Y probably damaging Het
Wnt9a G A 11: 59,328,757 G203D probably damaging Het
Xrn2 T C 2: 147,029,756 I366T probably damaging Het
Zfp280d A G 9: 72,361,942 D787G possibly damaging Het
Zfp706 T C 15: 37,001,925 T53A probably damaging Het
Other mutations in Gria4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Gria4 APN 9 4472202 missense probably damaging 0.98
IGL01451:Gria4 APN 9 4503652 missense probably benign 0.04
IGL01533:Gria4 APN 9 4502395 missense probably damaging 1.00
IGL01994:Gria4 APN 9 4537726 missense probably damaging 1.00
IGL02078:Gria4 APN 9 4793878 missense probably damaging 0.98
IGL02183:Gria4 APN 9 4502460 missense probably damaging 1.00
IGL02351:Gria4 APN 9 4456206 missense possibly damaging 0.84
IGL02358:Gria4 APN 9 4456206 missense possibly damaging 0.84
IGL03118:Gria4 APN 9 4793804 splice site probably benign
IGL03131:Gria4 APN 9 4432876 missense probably damaging 0.96
IGL03148:Gria4 APN 9 4464295 missense possibly damaging 0.91
IGL03264:Gria4 APN 9 4513288 missense probably benign
PIT4812001:Gria4 UTSW 9 4427128 missense probably damaging 1.00
R0018:Gria4 UTSW 9 4432843 missense possibly damaging 0.71
R0295:Gria4 UTSW 9 4793840 missense possibly damaging 0.69
R0654:Gria4 UTSW 9 4464372 missense probably benign 0.32
R0690:Gria4 UTSW 9 4427071 missense probably damaging 1.00
R0992:Gria4 UTSW 9 4795238 missense probably benign
R1517:Gria4 UTSW 9 4793865 missense probably damaging 1.00
R1673:Gria4 UTSW 9 4537637 nonsense probably null
R1713:Gria4 UTSW 9 4424448 missense probably benign 0.20
R1961:Gria4 UTSW 9 4519546 splice site probably benign
R2137:Gria4 UTSW 9 4427026 intron probably benign
R2397:Gria4 UTSW 9 4537717 missense probably damaging 1.00
R2870:Gria4 UTSW 9 4503614 missense probably damaging 0.96
R2870:Gria4 UTSW 9 4503614 missense probably damaging 0.96
R3014:Gria4 UTSW 9 4464294 missense probably damaging 0.97
R3412:Gria4 UTSW 9 4513278 missense probably benign 0.00
R3732:Gria4 UTSW 9 4513295 missense probably benign
R3732:Gria4 UTSW 9 4513295 missense probably benign
R3733:Gria4 UTSW 9 4513295 missense probably benign
R3897:Gria4 UTSW 9 4513260 missense probably damaging 1.00
R4404:Gria4 UTSW 9 4464489 splice site probably null
R4457:Gria4 UTSW 9 4427074 missense probably damaging 1.00
R4672:Gria4 UTSW 9 4664981 missense possibly damaging 0.96
R4865:Gria4 UTSW 9 4464295 missense possibly damaging 0.91
R5092:Gria4 UTSW 9 4472176 missense probably benign 0.01
R5109:Gria4 UTSW 9 4472168 missense probably damaging 1.00
R5202:Gria4 UTSW 9 4424330 missense probably benign 0.10
R5828:Gria4 UTSW 9 4432832 missense probably damaging 1.00
R5945:Gria4 UTSW 9 4456122 missense probably damaging 1.00
R5985:Gria4 UTSW 9 4503593 missense probably damaging 0.99
R6036:Gria4 UTSW 9 4537646 missense probably benign 0.00
R6036:Gria4 UTSW 9 4537646 missense probably benign 0.00
R6111:Gria4 UTSW 9 4502430 missense probably damaging 1.00
R6190:Gria4 UTSW 9 4420199 missense probably benign
R6280:Gria4 UTSW 9 4456072 missense probably damaging 1.00
R6406:Gria4 UTSW 9 4427077 missense probably damaging 1.00
R6470:Gria4 UTSW 9 4503680 missense probably damaging 1.00
R6485:Gria4 UTSW 9 4464249 missense probably damaging 1.00
R6612:Gria4 UTSW 9 4472206 missense possibly damaging 0.93
R6848:Gria4 UTSW 9 4793822 missense probably damaging 1.00
R7046:Gria4 UTSW 9 4420278 missense probably damaging 0.97
R7210:Gria4 UTSW 9 4464135 missense probably damaging 1.00
R7284:Gria4 UTSW 9 4472017 missense probably damaging 1.00
R7475:Gria4 UTSW 9 4513330 missense probably damaging 1.00
R7536:Gria4 UTSW 9 4464298 missense probably damaging 1.00
R7604:Gria4 UTSW 9 4464315 missense probably damaging 1.00
R7643:Gria4 UTSW 9 4793950 missense probably benign 0.00
R7669:Gria4 UTSW 9 4462029 missense probably damaging 1.00
R7703:Gria4 UTSW 9 4503588 missense probably benign
R7720:Gria4 UTSW 9 4464288 missense probably damaging 1.00
R7724:Gria4 UTSW 9 4472074 missense probably damaging 1.00
R7909:Gria4 UTSW 9 4464450 missense probably damaging 1.00
R8007:Gria4 UTSW 9 4503740 splice site probably benign
R8044:Gria4 UTSW 9 4456216 missense probably damaging 1.00
R8062:Gria4 UTSW 9 4480273 missense possibly damaging 0.54
R8131:Gria4 UTSW 9 4502429 missense probably benign 0.16
R8212:Gria4 UTSW 9 4480242 missense probably benign
X0023:Gria4 UTSW 9 4427067 missense probably damaging 1.00
X0065:Gria4 UTSW 9 4464340 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GCCACATTACTCCCACTGTG -3'
(R):5'- AATGACATTCCAGAGAGCTGAG -3'

Sequencing Primer
(F):5'- CATTACTCCCACTGTGAATTATAGGG -3'
(R):5'- CATTCCAGAGAGCTGAGTGTAAC -3'
Posted On2019-10-17