Incidental Mutation 'R7501:Hnrnph1'
ID581489
Institutional Source Beutler Lab
Gene Symbol Hnrnph1
Ensembl Gene ENSMUSG00000007850
Gene Nameheterogeneous nuclear ribonucleoprotein H1
SynonymsE430005G16Rik, Hnrph1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7501 (G1)
Quality Score124.008
Status Validated
Chromosome11
Chromosomal Location50376990-50386528 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 50379556 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 62 (E62D)
Ref Sequence ENSEMBL: ENSMUSP00000076989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069304] [ENSMUST00000077817] [ENSMUST00000109142]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069304
AA Change: E62D

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070503
Gene: ENSMUSG00000007850
AA Change: E62D

DomainStartEndE-ValueType
RRM 12 86 3.77e-10 SMART
RRM 112 184 2.59e-8 SMART
low complexity region 236 254 N/A INTRINSIC
RRM 290 360 1.45e-11 SMART
low complexity region 383 401 N/A INTRINSIC
low complexity region 413 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077817
AA Change: E62D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000076989
Gene: ENSMUSG00000007850
AA Change: E62D

DomainStartEndE-ValueType
RRM 12 86 3.77e-10 SMART
RRM 112 184 2.59e-8 SMART
low complexity region 236 254 N/A INTRINSIC
RRM 290 360 1.45e-11 SMART
low complexity region 383 401 N/A INTRINSIC
low complexity region 413 437 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109142
AA Change: E62D

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104770
Gene: ENSMUSG00000007850
AA Change: E62D

DomainStartEndE-ValueType
RRM 12 86 3.77e-10 SMART
RRM 112 184 2.59e-8 SMART
low complexity region 236 254 N/A INTRINSIC
RRM 290 360 1.45e-11 SMART
low complexity region 383 401 N/A INTRINSIC
low complexity region 413 433 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins that complex with heterogeneous nuclear RNA. These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some may shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has three repeats of quasi-RRM domains that bind to RNA and is very similar to the family member HNRPF. This gene may be associated with hereditary lymphedema type I. Alternatively spliced transcript variants have been described [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 A G 3: 36,088,825 N503S probably benign Het
Adam1a C T 5: 121,518,948 A761T possibly damaging Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Ankrd44 T C 1: 54,649,363 E238G Het
Ap3b2 A T 7: 81,473,446 I440K probably damaging Het
Atp2a1 G A 7: 126,450,172 T566I probably benign Het
B3galnt1 T C 3: 69,575,299 I210V probably benign Het
Bag5 T C 12: 111,710,288 K367R probably benign Het
Cdc25b T C 2: 131,194,160 Y410H probably damaging Het
Cgref1 G T 5: 30,945,456 P7Q probably damaging Het
Cnot6 T C 11: 49,685,332 I136V probably benign Het
Comp A G 8: 70,379,409 D500G possibly damaging Het
Dnah7b T C 1: 46,356,554 L3872P probably damaging Het
Dync2h1 A T 9: 7,175,336 L91Q possibly damaging Het
Fancd2 T C 6: 113,548,403 V280A possibly damaging Het
Fat4 T A 3: 38,958,448 Y2297* probably null Het
Fem1c A T 18: 46,505,801 M378K probably damaging Het
Gata6 A G 18: 11,054,082 T4A probably damaging Het
Gatb G C 3: 85,636,990 V422L probably damaging Het
Gfpt1 T A 6: 87,082,526 D510E probably benign Het
Gm12394 T C 4: 42,791,357 E925G probably damaging Het
Gria4 A T 9: 4,502,436 Y366N probably benign Het
Gucy1b1 T C 3: 82,035,359 H492R probably damaging Het
Hecw2 T C 1: 53,913,872 probably null Het
Hist1h2be A G 13: 23,585,793 I55T possibly damaging Het
Itga2 A G 13: 114,875,559 V274A probably damaging Het
Kdm5d T A Y: 941,488 W1230R probably damaging Het
Lctl A T 9: 64,131,579 M317L probably benign Het
Lrp6 T C 6: 134,486,508 D570G probably damaging Het
Lrrc9 G T 12: 72,449,716 M39I probably damaging Het
Ltbp2 A T 12: 84,830,645 I402N probably damaging Het
Mst1 G A 9: 108,082,549 G297D probably damaging Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Nbr1 G A 11: 101,566,200 R163Q probably damaging Het
Nlrp4f A G 13: 65,194,329 F501L probably damaging Het
Nup133 A C 8: 123,922,414 I563S probably benign Het
Oacyl T G 18: 65,725,298 probably null Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna2 C T 1: 194,643,895 R46C possibly damaging Het
Ppp1r26 T A 2: 28,450,737 D126E probably damaging Het
Prl6a1 A T 13: 27,316,299 R84S possibly damaging Het
Ptprz1 C T 6: 23,001,747 Q1279* probably null Het
Ptx4 C T 17: 25,125,192 T472I possibly damaging Het
Rabgap1l A G 1: 160,700,788 V416A probably damaging Het
Rbfox2 A T 15: 77,105,634 D231E probably benign Het
Reln A T 5: 22,227,638 F121L possibly damaging Het
Rfx7 G A 9: 72,616,772 V415I probably benign Het
Scaf4 A T 16: 90,230,076 M951K unknown Het
Sdf4 T C 4: 155,996,520 probably null Het
Sec16a T C 2: 26,441,851 T51A probably damaging Het
Sema3a A G 5: 13,557,041 N281S probably damaging Het
Snai2 G A 16: 14,706,890 V87I possibly damaging Het
Synj2 T A 17: 5,990,239 S197T possibly damaging Het
Syt6 A T 3: 103,587,702 M328L probably benign Het
Tdrd12 A G 7: 35,478,091 V946A unknown Het
Trat1 A T 16: 48,754,294 probably null Het
Vmn1r75 T A 7: 11,881,070 I243K possibly damaging Het
Vmn2r83 G A 10: 79,491,937 C793Y probably damaging Het
Wnt9a G A 11: 59,328,757 G203D probably damaging Het
Xrn2 T C 2: 147,029,756 I366T probably damaging Het
Zfp280d A G 9: 72,361,942 D787G possibly damaging Het
Zfp706 T C 15: 37,001,925 T53A probably damaging Het
Other mutations in Hnrnph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0480:Hnrnph1 UTSW 11 50385762 splice site probably benign
R2172:Hnrnph1 UTSW 11 50382816 missense probably benign 0.11
R3150:Hnrnph1 UTSW 11 50385792 missense probably benign
R4908:Hnrnph1 UTSW 11 50378410 missense probably damaging 0.97
R5661:Hnrnph1 UTSW 11 50384680 missense probably benign
R6194:Hnrnph1 UTSW 11 50383277 missense possibly damaging 0.89
R7650:Hnrnph1 UTSW 11 50383899 missense probably benign
R7745:Hnrnph1 UTSW 11 50379497 missense probably damaging 1.00
R8172:Hnrnph1 UTSW 11 50379905 missense probably damaging 0.99
X0021:Hnrnph1 UTSW 11 50379479 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCATTGAGTTACCTTGTTGGAC -3'
(R):5'- AGATGACCATTTCCATGCGG -3'

Sequencing Primer
(F):5'- ACCTTGTTGGACTAGGAATATATCC -3'
(R):5'- TGACCATTTCCATGCGGTCAAATAC -3'
Posted On2019-10-17