Incidental Mutation 'R7501:Wnt9a'
ID581490
Institutional Source Beutler Lab
Gene Symbol Wnt9a
Ensembl Gene ENSMUSG00000000126
Gene Namewingless-type MMTV integration site family, member 9A
SynonymsWnt14
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7501 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location59306928-59333552 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59328757 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 203 (G203D)
Ref Sequence ENSEMBL: ENSMUSP00000104411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000128] [ENSMUST00000108783]
Predicted Effect probably damaging
Transcript: ENSMUST00000000128
AA Change: G203D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000000128
Gene: ENSMUSG00000000126
AA Change: G203D

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 37 52 N/A INTRINSIC
WNT1 59 364 5.57e-82 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108783
AA Change: G203D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104411
Gene: ENSMUSG00000000126
AA Change: G203D

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 37 52 N/A INTRINSIC
WNT1 59 364 8.97e-86 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes that encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is expressed in gastric cancer cell lines. The protein encoded by this gene shows 75% amino acid identity to chicken Wnt14, which has been shown to play a central role in initiating synovial joint formation in the chick limb. This gene is clustered with another family member, WNT3A, in the chromosome 1q42 region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene results in neonatal lethality, altered chondrocyte maturation, cranial defects, and skeletal abnormalities including shortened appendicular long bones, partial joint fusions of carpal and tarsal elements, and chondroid metaplasia in synovial and fibrous joints. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 A G 3: 36,088,825 N503S probably benign Het
Adam1a C T 5: 121,518,948 A761T possibly damaging Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Ankrd44 T C 1: 54,649,363 E238G Het
Ap3b2 A T 7: 81,473,446 I440K probably damaging Het
Atp2a1 G A 7: 126,450,172 T566I probably benign Het
B3galnt1 T C 3: 69,575,299 I210V probably benign Het
Bag5 T C 12: 111,710,288 K367R probably benign Het
Cdc25b T C 2: 131,194,160 Y410H probably damaging Het
Cgref1 G T 5: 30,945,456 P7Q probably damaging Het
Cnot6 T C 11: 49,685,332 I136V probably benign Het
Comp A G 8: 70,379,409 D500G possibly damaging Het
Dnah7b T C 1: 46,356,554 L3872P probably damaging Het
Dync2h1 A T 9: 7,175,336 L91Q possibly damaging Het
Fancd2 T C 6: 113,548,403 V280A possibly damaging Het
Fat4 T A 3: 38,958,448 Y2297* probably null Het
Fem1c A T 18: 46,505,801 M378K probably damaging Het
Gata6 A G 18: 11,054,082 T4A probably damaging Het
Gatb G C 3: 85,636,990 V422L probably damaging Het
Gfpt1 T A 6: 87,082,526 D510E probably benign Het
Gm12394 T C 4: 42,791,357 E925G probably damaging Het
Gria4 A T 9: 4,502,436 Y366N probably benign Het
Gucy1b1 T C 3: 82,035,359 H492R probably damaging Het
Hecw2 T C 1: 53,913,872 probably null Het
Hist1h2be A G 13: 23,585,793 I55T possibly damaging Het
Hnrnph1 A C 11: 50,379,556 E62D probably benign Het
Itga2 A G 13: 114,875,559 V274A probably damaging Het
Kdm5d T A Y: 941,488 W1230R probably damaging Het
Lctl A T 9: 64,131,579 M317L probably benign Het
Lrp6 T C 6: 134,486,508 D570G probably damaging Het
Lrrc9 G T 12: 72,449,716 M39I probably damaging Het
Ltbp2 A T 12: 84,830,645 I402N probably damaging Het
Mst1 G A 9: 108,082,549 G297D probably damaging Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Nbr1 G A 11: 101,566,200 R163Q probably damaging Het
Nlrp4f A G 13: 65,194,329 F501L probably damaging Het
Nup133 A C 8: 123,922,414 I563S probably benign Het
Oacyl T G 18: 65,725,298 probably null Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna2 C T 1: 194,643,895 R46C possibly damaging Het
Ppp1r26 T A 2: 28,450,737 D126E probably damaging Het
Prl6a1 A T 13: 27,316,299 R84S possibly damaging Het
Ptprz1 C T 6: 23,001,747 Q1279* probably null Het
Ptx4 C T 17: 25,125,192 T472I possibly damaging Het
Rabgap1l A G 1: 160,700,788 V416A probably damaging Het
Rbfox2 A T 15: 77,105,634 D231E probably benign Het
Reln A T 5: 22,227,638 F121L possibly damaging Het
Rfx7 G A 9: 72,616,772 V415I probably benign Het
Scaf4 A T 16: 90,230,076 M951K unknown Het
Sdf4 T C 4: 155,996,520 probably null Het
Sec16a T C 2: 26,441,851 T51A probably damaging Het
Sema3a A G 5: 13,557,041 N281S probably damaging Het
Snai2 G A 16: 14,706,890 V87I possibly damaging Het
Synj2 T A 17: 5,990,239 S197T possibly damaging Het
Syt6 A T 3: 103,587,702 M328L probably benign Het
Tdrd12 A G 7: 35,478,091 V946A unknown Het
Trat1 A T 16: 48,754,294 probably null Het
Vmn1r75 T A 7: 11,881,070 I243K possibly damaging Het
Vmn2r83 G A 10: 79,491,937 C793Y probably damaging Het
Xrn2 T C 2: 147,029,756 I366T probably damaging Het
Zfp280d A G 9: 72,361,942 D787G possibly damaging Het
Zfp706 T C 15: 37,001,925 T53A probably damaging Het
Other mutations in Wnt9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02526:Wnt9a APN 11 59328505 missense probably damaging 0.99
IGL02550:Wnt9a APN 11 59330918 missense probably damaging 1.00
IGL03131:Wnt9a APN 11 59331029 missense probably damaging 0.97
IGL03347:Wnt9a APN 11 59330914 missense probably damaging 1.00
R1764:Wnt9a UTSW 11 59330902 missense probably benign 0.13
R2073:Wnt9a UTSW 11 59331229 missense probably damaging 1.00
R4502:Wnt9a UTSW 11 59328537 missense probably damaging 1.00
R4571:Wnt9a UTSW 11 59331337 missense probably damaging 1.00
R4845:Wnt9a UTSW 11 59331241 missense probably benign 0.24
R5268:Wnt9a UTSW 11 59328570 missense probably damaging 1.00
Z1177:Wnt9a UTSW 11 59331163 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGACTGCTTTCCTCTACGC -3'
(R):5'- ATCTAAGCAGGGTTCCAGGAC -3'

Sequencing Primer
(F):5'- ACGCATGCACTGGCCAAG -3'
(R):5'- ACCCTACCTGGTACTGCGTG -3'
Posted On2019-10-17