Incidental Mutation 'R7501:Ltbp2'
ID581493
Institutional Source Beutler Lab
Gene Symbol Ltbp2
Ensembl Gene ENSMUSG00000002020
Gene Namelatent transforming growth factor beta binding protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.789) question?
Stock #R7501 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location84783212-84876532 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84830645 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 402 (I402N)
Ref Sequence ENSEMBL: ENSMUSP00000105883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002073] [ENSMUST00000110254] [ENSMUST00000163189]
Predicted Effect probably damaging
Transcript: ENSMUST00000002073
AA Change: I382N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002073
Gene: ENSMUSG00000002020
AA Change: I382N

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
EGF 184 213 6.55e-1 SMART
low complexity region 255 275 N/A INTRINSIC
EGF 384 413 8.19e-2 SMART
low complexity region 515 526 N/A INTRINSIC
Pfam:TB 546 582 3.8e-9 PFAM
EGF_CA 606 646 8.05e-10 SMART
Pfam:TB 666 707 3.4e-17 PFAM
EGF_CA 832 874 7.18e-7 SMART
EGF_CA 875 917 1.75e-10 SMART
EGF_CA 918 957 1.53e-10 SMART
EGF_CA 958 997 3.51e-10 SMART
EGF_CA 998 1038 8.3e-12 SMART
EGF_CA 1039 1080 4.56e-9 SMART
EGF_CA 1081 1122 4.56e-9 SMART
EGF_CA 1123 1163 8.76e-11 SMART
EGF_CA 1164 1205 4.38e-11 SMART
EGF_CA 1206 1246 1.75e-10 SMART
EGF_CA 1247 1290 2.24e-8 SMART
EGF_CA 1291 1332 6.01e-9 SMART
EGF 1336 1375 1.95e1 SMART
Pfam:TB 1410 1450 1.4e-13 PFAM
EGF_CA 1473 1515 2.31e-10 SMART
EGF_CA 1516 1555 7.93e-9 SMART
Pfam:TB 1582 1623 1e-13 PFAM
low complexity region 1691 1704 N/A INTRINSIC
EGF 1724 1761 4e-5 SMART
EGF_CA 1762 1806 1.91e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110254
AA Change: I402N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105883
Gene: ENSMUSG00000002020
AA Change: I402N

DomainStartEndE-ValueType
low complexity region 119 128 N/A INTRINSIC
EGF 204 233 6.55e-1 SMART
low complexity region 275 295 N/A INTRINSIC
EGF 404 433 8.19e-2 SMART
low complexity region 535 546 N/A INTRINSIC
Pfam:TB 565 602 4e-8 PFAM
EGF_CA 626 666 8.05e-10 SMART
Pfam:TB 685 727 3.7e-16 PFAM
EGF_CA 852 894 7.18e-7 SMART
EGF_CA 895 934 1.53e-10 SMART
EGF_CA 935 974 3.51e-10 SMART
EGF_CA 975 1015 8.3e-12 SMART
EGF_CA 1016 1057 4.56e-9 SMART
EGF_CA 1058 1099 4.56e-9 SMART
EGF_CA 1100 1140 8.76e-11 SMART
EGF_CA 1141 1182 4.38e-11 SMART
EGF_CA 1183 1223 1.75e-10 SMART
EGF_CA 1224 1267 2.24e-8 SMART
EGF_CA 1268 1309 6.01e-9 SMART
EGF 1313 1352 1.95e1 SMART
Pfam:TB 1387 1427 1.4e-11 PFAM
EGF_CA 1450 1492 2.31e-10 SMART
EGF_CA 1493 1532 7.93e-9 SMART
Pfam:TB 1558 1600 4.6e-13 PFAM
low complexity region 1668 1681 N/A INTRINSIC
EGF 1701 1738 4e-5 SMART
EGF_CA 1739 1783 1.91e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163189
AA Change: I382N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127693
Gene: ENSMUSG00000002020
AA Change: I382N

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
EGF 184 213 6.55e-1 SMART
low complexity region 255 275 N/A INTRINSIC
EGF 384 413 8.19e-2 SMART
low complexity region 515 526 N/A INTRINSIC
Pfam:TB 545 582 4e-8 PFAM
EGF_CA 606 646 8.05e-10 SMART
Pfam:TB 665 707 3.8e-16 PFAM
EGF_CA 832 874 7.18e-7 SMART
EGF_CA 875 914 1.53e-10 SMART
EGF_CA 915 954 3.51e-10 SMART
EGF_CA 955 995 8.3e-12 SMART
EGF_CA 996 1037 4.56e-9 SMART
EGF_CA 1038 1079 4.56e-9 SMART
EGF_CA 1080 1120 8.76e-11 SMART
EGF_CA 1121 1162 4.38e-11 SMART
EGF_CA 1163 1203 1.75e-10 SMART
EGF_CA 1204 1247 2.24e-8 SMART
EGF_CA 1248 1289 6.01e-9 SMART
EGF 1293 1332 1.95e1 SMART
Pfam:TB 1367 1407 1.5e-11 PFAM
EGF_CA 1430 1472 2.31e-10 SMART
EGF_CA 1473 1512 7.93e-9 SMART
Pfam:TB 1538 1580 4.7e-13 PFAM
low complexity region 1648 1661 N/A INTRINSIC
EGF 1681 1718 4e-5 SMART
EGF_CA 1719 1763 1.91e-11 SMART
Meta Mutation Damage Score 0.2659 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of latent transforming growth factor (TGF)-beta binding proteins (LTBP), which are extracellular matrix proteins with multi-domain structure. This protein is the largest member of the LTBP family possessing unique regions and with most similarity to the fibrillins. It has thus been suggested that it may have multiple functions: as a member of the TGF-beta latent complex, as a structural component of microfibrils, and a role in cell adhesion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit early embryonic lethality prior to E6.5. Mice homozygous for a different null allele are viable, fertile, and developmentally normal but develop lens dislocations due to ciliary zonule fragmentation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 A G 3: 36,088,825 N503S probably benign Het
Adam1a C T 5: 121,518,948 A761T possibly damaging Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Ankrd44 T C 1: 54,649,363 E238G Het
Ap3b2 A T 7: 81,473,446 I440K probably damaging Het
Atp2a1 G A 7: 126,450,172 T566I probably benign Het
B3galnt1 T C 3: 69,575,299 I210V probably benign Het
Bag5 T C 12: 111,710,288 K367R probably benign Het
Cdc25b T C 2: 131,194,160 Y410H probably damaging Het
Cgref1 G T 5: 30,945,456 P7Q probably damaging Het
Cnot6 T C 11: 49,685,332 I136V probably benign Het
Comp A G 8: 70,379,409 D500G possibly damaging Het
Dnah7b T C 1: 46,356,554 L3872P probably damaging Het
Dync2h1 A T 9: 7,175,336 L91Q possibly damaging Het
Fancd2 T C 6: 113,548,403 V280A possibly damaging Het
Fat4 T A 3: 38,958,448 Y2297* probably null Het
Fem1c A T 18: 46,505,801 M378K probably damaging Het
Gata6 A G 18: 11,054,082 T4A probably damaging Het
Gatb G C 3: 85,636,990 V422L probably damaging Het
Gfpt1 T A 6: 87,082,526 D510E probably benign Het
Gm12394 T C 4: 42,791,357 E925G probably damaging Het
Gria4 A T 9: 4,502,436 Y366N probably benign Het
Gucy1b1 T C 3: 82,035,359 H492R probably damaging Het
Hecw2 T C 1: 53,913,872 probably null Het
Hist1h2be A G 13: 23,585,793 I55T possibly damaging Het
Hnrnph1 A C 11: 50,379,556 E62D probably benign Het
Itga2 A G 13: 114,875,559 V274A probably damaging Het
Kdm5d T A Y: 941,488 W1230R probably damaging Het
Lctl A T 9: 64,131,579 M317L probably benign Het
Lrp6 T C 6: 134,486,508 D570G probably damaging Het
Lrrc9 G T 12: 72,449,716 M39I probably damaging Het
Mst1 G A 9: 108,082,549 G297D probably damaging Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Nbr1 G A 11: 101,566,200 R163Q probably damaging Het
Nlrp4f A G 13: 65,194,329 F501L probably damaging Het
Nup133 A C 8: 123,922,414 I563S probably benign Het
Oacyl T G 18: 65,725,298 probably null Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna2 C T 1: 194,643,895 R46C possibly damaging Het
Ppp1r26 T A 2: 28,450,737 D126E probably damaging Het
Prl6a1 A T 13: 27,316,299 R84S possibly damaging Het
Ptprz1 C T 6: 23,001,747 Q1279* probably null Het
Ptx4 C T 17: 25,125,192 T472I possibly damaging Het
Rabgap1l A G 1: 160,700,788 V416A probably damaging Het
Rbfox2 A T 15: 77,105,634 D231E probably benign Het
Reln A T 5: 22,227,638 F121L possibly damaging Het
Rfx7 G A 9: 72,616,772 V415I probably benign Het
Scaf4 A T 16: 90,230,076 M951K unknown Het
Sdf4 T C 4: 155,996,520 probably null Het
Sec16a T C 2: 26,441,851 T51A probably damaging Het
Sema3a A G 5: 13,557,041 N281S probably damaging Het
Snai2 G A 16: 14,706,890 V87I possibly damaging Het
Synj2 T A 17: 5,990,239 S197T possibly damaging Het
Syt6 A T 3: 103,587,702 M328L probably benign Het
Tdrd12 A G 7: 35,478,091 V946A unknown Het
Trat1 A T 16: 48,754,294 probably null Het
Vmn1r75 T A 7: 11,881,070 I243K possibly damaging Het
Vmn2r83 G A 10: 79,491,937 C793Y probably damaging Het
Wnt9a G A 11: 59,328,757 G203D probably damaging Het
Xrn2 T C 2: 147,029,756 I366T probably damaging Het
Zfp280d A G 9: 72,361,942 D787G possibly damaging Het
Zfp706 T C 15: 37,001,925 T53A probably damaging Het
Other mutations in Ltbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Ltbp2 APN 12 84791064 missense probably damaging 1.00
IGL00938:Ltbp2 APN 12 84831799 missense probably benign 0.03
IGL01397:Ltbp2 APN 12 84790268 missense probably damaging 1.00
IGL01570:Ltbp2 APN 12 84794033 missense probably benign 0.05
IGL01631:Ltbp2 APN 12 84809146 critical splice donor site probably null
IGL01662:Ltbp2 APN 12 84809246 missense probably benign 0.00
IGL01728:Ltbp2 APN 12 84791009 missense probably damaging 0.99
IGL01839:Ltbp2 APN 12 84793658 missense possibly damaging 0.48
IGL01946:Ltbp2 APN 12 84830748 missense probably damaging 1.00
IGL01977:Ltbp2 APN 12 84830199 missense probably damaging 1.00
IGL02220:Ltbp2 APN 12 84829309 missense possibly damaging 0.93
IGL02340:Ltbp2 APN 12 84792955 critical splice donor site probably null
IGL02430:Ltbp2 APN 12 84799401 missense probably damaging 1.00
IGL02492:Ltbp2 APN 12 84809665 missense probably damaging 1.00
IGL02517:Ltbp2 APN 12 84785317 missense probably benign 0.42
IGL02794:Ltbp2 APN 12 84791935 missense probably damaging 1.00
deft UTSW 12 84853912 missense probably damaging 0.98
R0045:Ltbp2 UTSW 12 84809587 missense probably damaging 1.00
R0045:Ltbp2 UTSW 12 84813288 missense probably damaging 1.00
R0091:Ltbp2 UTSW 12 84793733 missense probably damaging 1.00
R0094:Ltbp2 UTSW 12 84799426 missense probably damaging 1.00
R0166:Ltbp2 UTSW 12 84786358 missense probably benign 0.28
R0265:Ltbp2 UTSW 12 84785969 splice site probably null
R0394:Ltbp2 UTSW 12 84806424 splice site probably benign
R0535:Ltbp2 UTSW 12 84784858 missense probably damaging 1.00
R0535:Ltbp2 UTSW 12 84791052 missense probably damaging 1.00
R1465:Ltbp2 UTSW 12 84813300 missense probably damaging 1.00
R1465:Ltbp2 UTSW 12 84813300 missense probably damaging 1.00
R1513:Ltbp2 UTSW 12 84791944 missense probably damaging 1.00
R1858:Ltbp2 UTSW 12 84830781 nonsense probably null
R1880:Ltbp2 UTSW 12 84829271 missense probably benign 0.45
R1894:Ltbp2 UTSW 12 84787961 missense probably damaging 1.00
R1900:Ltbp2 UTSW 12 84830658 missense probably damaging 1.00
R1903:Ltbp2 UTSW 12 84830105 missense probably benign 0.01
R1912:Ltbp2 UTSW 12 84785863 missense probably damaging 0.98
R1993:Ltbp2 UTSW 12 84808446 critical splice acceptor site probably null
R1995:Ltbp2 UTSW 12 84808446 critical splice acceptor site probably null
R2069:Ltbp2 UTSW 12 84793733 missense probably damaging 1.00
R2126:Ltbp2 UTSW 12 84785709 splice site probably null
R2139:Ltbp2 UTSW 12 84815979 missense probably damaging 1.00
R2341:Ltbp2 UTSW 12 84809163 missense probably benign 0.08
R2511:Ltbp2 UTSW 12 84804409 splice site probably null
R3737:Ltbp2 UTSW 12 84804474 missense probably damaging 1.00
R3738:Ltbp2 UTSW 12 84804474 missense probably damaging 1.00
R3739:Ltbp2 UTSW 12 84804474 missense probably damaging 1.00
R3889:Ltbp2 UTSW 12 84784907 unclassified probably benign
R4034:Ltbp2 UTSW 12 84804474 missense probably damaging 1.00
R4542:Ltbp2 UTSW 12 84831819 nonsense probably null
R4621:Ltbp2 UTSW 12 84809348 missense probably damaging 1.00
R4623:Ltbp2 UTSW 12 84809348 missense probably damaging 1.00
R4831:Ltbp2 UTSW 12 84793640 missense possibly damaging 0.55
R5080:Ltbp2 UTSW 12 84803864 missense probably damaging 1.00
R5116:Ltbp2 UTSW 12 84809737 missense probably damaging 1.00
R5351:Ltbp2 UTSW 12 84790358 missense possibly damaging 0.95
R5445:Ltbp2 UTSW 12 84809654 missense probably null 1.00
R5608:Ltbp2 UTSW 12 84787464 splice site probably null
R5784:Ltbp2 UTSW 12 84868739 missense probably damaging 1.00
R5838:Ltbp2 UTSW 12 84789101 missense probably benign 0.16
R5859:Ltbp2 UTSW 12 84794063 missense possibly damaging 0.52
R6004:Ltbp2 UTSW 12 84876149 missense probably benign 0.00
R6028:Ltbp2 UTSW 12 84784852 missense probably damaging 1.00
R6347:Ltbp2 UTSW 12 84853912 missense probably damaging 0.98
R6615:Ltbp2 UTSW 12 84813317 missense probably damaging 1.00
R6636:Ltbp2 UTSW 12 84875838 missense probably benign 0.00
R6637:Ltbp2 UTSW 12 84875838 missense probably benign 0.00
R6755:Ltbp2 UTSW 12 84795073 missense probably damaging 1.00
R6759:Ltbp2 UTSW 12 84787410 missense probably damaging 0.99
R6806:Ltbp2 UTSW 12 84809238 missense possibly damaging 0.74
R6968:Ltbp2 UTSW 12 84789083 critical splice donor site probably null
R7084:Ltbp2 UTSW 12 84868685 missense probably damaging 1.00
R7250:Ltbp2 UTSW 12 84787392 nonsense probably null
R7374:Ltbp2 UTSW 12 84830175 missense probably damaging 1.00
R7523:Ltbp2 UTSW 12 84791034 missense probably benign 0.00
R7754:Ltbp2 UTSW 12 84813238 critical splice donor site probably null
R7827:Ltbp2 UTSW 12 84789881 missense probably benign 0.19
R8042:Ltbp2 UTSW 12 84791899 missense probably damaging 0.99
R8110:Ltbp2 UTSW 12 84803902 nonsense probably null
R8411:Ltbp2 UTSW 12 84786413 missense probably damaging 1.00
X0017:Ltbp2 UTSW 12 84828528 missense probably damaging 1.00
X0026:Ltbp2 UTSW 12 84830199 missense probably damaging 1.00
Z1176:Ltbp2 UTSW 12 84875853 missense probably benign 0.01
Z1177:Ltbp2 UTSW 12 84829316 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CAGAGGCCATGGTTCTTCTC -3'
(R):5'- TCCAGGACCCAAGTTCTCTC -3'

Sequencing Primer
(F):5'- GTGACTTGCTTGGAATCACACAGC -3'
(R):5'- TCTCTCTGCAGGGCTGAAC -3'
Posted On2019-10-17