Incidental Mutation 'R7501:Scaf4'
ID581502
Institutional Source Beutler Lab
Gene Symbol Scaf4
Ensembl Gene ENSMUSG00000022983
Gene NameSR-related CTD-associated factor 4
SynonymsSfrs15, Sra4, Srsf15
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.740) question?
Stock #R7501 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location90225680-90284503 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90230076 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 951 (M951K)
Ref Sequence ENSEMBL: ENSMUSP00000044472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023707] [ENSMUST00000039280] [ENSMUST00000163419] [ENSMUST00000232371]
Predicted Effect probably benign
Transcript: ENSMUST00000023707
SMART Domains Protein: ENSMUSP00000023707
Gene: ENSMUSG00000022982

DomainStartEndE-ValueType
Pfam:Sod_Cu 9 150 2.2e-51 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000039280
AA Change: M951K
SMART Domains Protein: ENSMUSP00000044472
Gene: ENSMUSG00000022983
AA Change: M951K

DomainStartEndE-ValueType
RPR 6 136 7.8e-48 SMART
low complexity region 190 214 N/A INTRINSIC
low complexity region 272 313 N/A INTRINSIC
low complexity region 360 389 N/A INTRINSIC
low complexity region 390 418 N/A INTRINSIC
low complexity region 420 448 N/A INTRINSIC
low complexity region 496 558 N/A INTRINSIC
RRM 574 643 7.47e-14 SMART
low complexity region 719 757 N/A INTRINSIC
low complexity region 762 829 N/A INTRINSIC
low complexity region 871 886 N/A INTRINSIC
low complexity region 937 980 N/A INTRINSIC
low complexity region 983 997 N/A INTRINSIC
low complexity region 1006 1046 N/A INTRINSIC
low complexity region 1082 1096 N/A INTRINSIC
low complexity region 1111 1145 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163419
AA Change: M925K
SMART Domains Protein: ENSMUSP00000132250
Gene: ENSMUSG00000022983
AA Change: M925K

DomainStartEndE-ValueType
RPR 6 136 7.8e-48 SMART
low complexity region 190 214 N/A INTRINSIC
low complexity region 272 313 N/A INTRINSIC
low complexity region 360 389 N/A INTRINSIC
low complexity region 390 418 N/A INTRINSIC
low complexity region 420 448 N/A INTRINSIC
low complexity region 496 554 N/A INTRINSIC
RRM 570 639 7.47e-14 SMART
low complexity region 715 753 N/A INTRINSIC
low complexity region 758 825 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
low complexity region 911 954 N/A INTRINSIC
low complexity region 957 971 N/A INTRINSIC
low complexity region 980 1020 N/A INTRINSIC
low complexity region 1056 1070 N/A INTRINSIC
low complexity region 1085 1119 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000232371
AA Change: M926K
Meta Mutation Damage Score 0.1158 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a member of the arginine/serine-rich splicing factor family. A similar protein in Rat appears to bind the large subunit of RNA polymerase II and provide a link between transcription and pre-mRNA splicing. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 A G 3: 36,088,825 N503S probably benign Het
Adam1a C T 5: 121,518,948 A761T possibly damaging Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Ankrd44 T C 1: 54,649,363 E238G Het
Ap3b2 A T 7: 81,473,446 I440K probably damaging Het
Atp2a1 G A 7: 126,450,172 T566I probably benign Het
B3galnt1 T C 3: 69,575,299 I210V probably benign Het
Bag5 T C 12: 111,710,288 K367R probably benign Het
Cdc25b T C 2: 131,194,160 Y410H probably damaging Het
Cgref1 G T 5: 30,945,456 P7Q probably damaging Het
Cnot6 T C 11: 49,685,332 I136V probably benign Het
Comp A G 8: 70,379,409 D500G possibly damaging Het
Dnah7b T C 1: 46,356,554 L3872P probably damaging Het
Dync2h1 A T 9: 7,175,336 L91Q possibly damaging Het
Fancd2 T C 6: 113,548,403 V280A possibly damaging Het
Fat4 T A 3: 38,958,448 Y2297* probably null Het
Fem1c A T 18: 46,505,801 M378K probably damaging Het
Gata6 A G 18: 11,054,082 T4A probably damaging Het
Gatb G C 3: 85,636,990 V422L probably damaging Het
Gfpt1 T A 6: 87,082,526 D510E probably benign Het
Gm12394 T C 4: 42,791,357 E925G probably damaging Het
Gria4 A T 9: 4,502,436 Y366N probably benign Het
Gucy1b1 T C 3: 82,035,359 H492R probably damaging Het
Hecw2 T C 1: 53,913,872 probably null Het
Hist1h2be A G 13: 23,585,793 I55T possibly damaging Het
Hnrnph1 A C 11: 50,379,556 E62D probably benign Het
Itga2 A G 13: 114,875,559 V274A probably damaging Het
Kdm5d T A Y: 941,488 W1230R probably damaging Het
Lctl A T 9: 64,131,579 M317L probably benign Het
Lrp6 T C 6: 134,486,508 D570G probably damaging Het
Lrrc9 G T 12: 72,449,716 M39I probably damaging Het
Ltbp2 A T 12: 84,830,645 I402N probably damaging Het
Mst1 G A 9: 108,082,549 G297D probably damaging Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Nbr1 G A 11: 101,566,200 R163Q probably damaging Het
Nlrp4f A G 13: 65,194,329 F501L probably damaging Het
Nup133 A C 8: 123,922,414 I563S probably benign Het
Oacyl T G 18: 65,725,298 probably null Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna2 C T 1: 194,643,895 R46C possibly damaging Het
Ppp1r26 T A 2: 28,450,737 D126E probably damaging Het
Prl6a1 A T 13: 27,316,299 R84S possibly damaging Het
Ptprz1 C T 6: 23,001,747 Q1279* probably null Het
Ptx4 C T 17: 25,125,192 T472I possibly damaging Het
Rabgap1l A G 1: 160,700,788 V416A probably damaging Het
Rbfox2 A T 15: 77,105,634 D231E probably benign Het
Reln A T 5: 22,227,638 F121L possibly damaging Het
Rfx7 G A 9: 72,616,772 V415I probably benign Het
Sdf4 T C 4: 155,996,520 probably null Het
Sec16a T C 2: 26,441,851 T51A probably damaging Het
Sema3a A G 5: 13,557,041 N281S probably damaging Het
Snai2 G A 16: 14,706,890 V87I possibly damaging Het
Synj2 T A 17: 5,990,239 S197T possibly damaging Het
Syt6 A T 3: 103,587,702 M328L probably benign Het
Tdrd12 A G 7: 35,478,091 V946A unknown Het
Trat1 A T 16: 48,754,294 probably null Het
Vmn1r75 T A 7: 11,881,070 I243K possibly damaging Het
Vmn2r83 G A 10: 79,491,937 C793Y probably damaging Het
Wnt9a G A 11: 59,328,757 G203D probably damaging Het
Xrn2 T C 2: 147,029,756 I366T probably damaging Het
Zfp280d A G 9: 72,361,942 D787G possibly damaging Het
Zfp706 T C 15: 37,001,925 T53A probably damaging Het
Other mutations in Scaf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Scaf4 APN 16 90247281 missense unknown
IGL00536:Scaf4 APN 16 90257362 missense unknown
IGL01122:Scaf4 APN 16 90248630 missense unknown
IGL02015:Scaf4 APN 16 90258846 missense unknown
IGL02074:Scaf4 APN 16 90242920 missense unknown
IGL02555:Scaf4 APN 16 90250305 missense unknown
IGL02735:Scaf4 APN 16 90245515 missense unknown
FR4304:Scaf4 UTSW 16 90229854 small deletion probably benign
FR4589:Scaf4 UTSW 16 90229854 small deletion probably benign
R0217:Scaf4 UTSW 16 90242682 missense probably damaging 0.99
R0410:Scaf4 UTSW 16 90260170 missense unknown
R0681:Scaf4 UTSW 16 90249694 missense unknown
R1099:Scaf4 UTSW 16 90263098 missense unknown
R1510:Scaf4 UTSW 16 90245394 missense unknown
R1694:Scaf4 UTSW 16 90229857 small deletion probably benign
R2077:Scaf4 UTSW 16 90252435 missense unknown
R2087:Scaf4 UTSW 16 90252425 missense unknown
R2182:Scaf4 UTSW 16 90230140 missense probably benign 0.15
R2698:Scaf4 UTSW 16 90244356 missense unknown
R2925:Scaf4 UTSW 16 90250289 missense unknown
R3025:Scaf4 UTSW 16 90251938 missense unknown
R3236:Scaf4 UTSW 16 90260217 missense unknown
R4207:Scaf4 UTSW 16 90260215 missense unknown
R4584:Scaf4 UTSW 16 90229515 unclassified probably benign
R4735:Scaf4 UTSW 16 90252432 missense unknown
R4835:Scaf4 UTSW 16 90250307 missense unknown
R4969:Scaf4 UTSW 16 90251943 nonsense probably null
R5174:Scaf4 UTSW 16 90247174 missense unknown
R5568:Scaf4 UTSW 16 90229857 small deletion probably benign
R5615:Scaf4 UTSW 16 90251960 missense unknown
R5638:Scaf4 UTSW 16 90244310 missense unknown
R6364:Scaf4 UTSW 16 90260248 nonsense probably null
R6470:Scaf4 UTSW 16 90229638 nonsense probably null
R7049:Scaf4 UTSW 16 90260187 missense unknown
R7198:Scaf4 UTSW 16 90252430 missense unknown
R7446:Scaf4 UTSW 16 90258770 missense unknown
R7580:Scaf4 UTSW 16 90229852 nonsense probably null
R7631:Scaf4 UTSW 16 90229557 missense unknown
R8380:Scaf4 UTSW 16 90260245 missense unknown
X0013:Scaf4 UTSW 16 90252291 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGAACTGCTGCCTGCTATC -3'
(R):5'- AGGCACTCAAGGAGTTGCAC -3'

Sequencing Primer
(F):5'- ATCATTTCTAAACTGCGGTGGC -3'
(R):5'- GCACCGGGTCCTGTAATTG -3'
Posted On2019-10-17