Mutagenetix > Incidental Mutation

Incidental Mutation 'R7501:Gata6'

581505

Institutional Source

Beutler Lab

Gene Symbol

Gata6

Ensembl Gene

ENSMUSG00000005836

Gene Name

GATA binding protein 6

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7501 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

11052508-11085635 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 11054082 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 4 (T4A)

Ref Sequence

ENSEMBL: ENSMUSP00000041774 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047762]

AlphaFold

Q61169

Predicted Effect

probably damaging
Transcript: ENSMUST00000047762
AA Change: T4A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000041774
Gene: ENSMUSG00000005836
AA Change: T4A

Domain	Start	End	E-Value	Type
low complexity region	14	29	N/A	INTRINSIC
low complexity region	32	47	N/A	INTRINSIC
low complexity region	84	105	N/A	INTRINSIC
Pfam:GATA-N	147	372	2.3e-62	PFAM
ZnF_GATA	378	429	4.23e-16	SMART
ZnF_GATA	432	482	3.62e-24	SMART

Meta Mutation Damage Score

0.0572

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a small family of zinc finger transcription factors that play an important role in the regulation of cellular differentiation and organogenesis during vertebrate development. This gene is expressed during early embryogenesis and localizes to endo- and mesodermally derived cells during later embryogenesis and thereby plays an important role in gut, lung, and heart development. Mutations in this gene are associated with several congenital defects. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous null mutant E5.5 embryos lack parts of the visceral endoderm, show impaired embryonic ectoderm development, and die soon post-implantation, apparently of extraembryonic tissue defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad9	A	G	3: 36,088,825	N503S	probably benign	Het
Adam1a	C	T	5: 121,518,948	A761T	possibly damaging	Het
Amn1	C	T	6: 149,185,031	M44I	probably benign	Het
Ankrd44	T	C	1: 54,649,363	E238G		Het
Ap3b2	A	T	7: 81,473,446	I440K	probably damaging	Het
Atp2a1	G	A	7: 126,450,172	T566I	probably benign	Het
B3galnt1	T	C	3: 69,575,299	I210V	probably benign	Het
Bag5	T	C	12: 111,710,288	K367R	probably benign	Het
Cdc25b	T	C	2: 131,194,160	Y410H	probably damaging	Het
Cgref1	G	T	5: 30,945,456	P7Q	probably damaging	Het
Cnot6	T	C	11: 49,685,332	I136V	probably benign	Het
Comp	A	G	8: 70,379,409	D500G	possibly damaging	Het
Dnah7b	T	C	1: 46,356,554	L3872P	probably damaging	Het
Dync2h1	A	T	9: 7,175,336	L91Q	possibly damaging	Het
Fancd2	T	C	6: 113,548,403	V280A	possibly damaging	Het
Fat4	T	A	3: 38,958,448	Y2297*	probably null	Het
Fem1c	A	T	18: 46,505,801	M378K	probably damaging	Het
Gatb	G	C	3: 85,636,990	V422L	probably damaging	Het
Gfpt1	T	A	6: 87,082,526	D510E	probably benign	Het
Gm12394	T	C	4: 42,791,357	E925G	probably damaging	Het
Gria4	A	T	9: 4,502,436	Y366N	probably benign	Het
Gucy1b1	T	C	3: 82,035,359	H492R	probably damaging	Het
Hecw2	T	C	1: 53,913,872		probably null	Het
Hist1h2be	A	G	13: 23,585,793	I55T	possibly damaging	Het
Hnrnph1	A	C	11: 50,379,556	E62D	probably benign	Het
Itga2	A	G	13: 114,875,559	V274A	probably damaging	Het
Kdm5d	T	A	Y: 941,488	W1230R	probably damaging	Het
Lctl	A	T	9: 64,131,579	M317L	probably benign	Het
Lrp6	T	C	6: 134,486,508	D570G	probably damaging	Het
Lrrc9	G	T	12: 72,449,716	M39I	probably damaging	Het
Ltbp2	A	T	12: 84,830,645	I402N	probably damaging	Het
Mst1	G	A	9: 108,082,549	G297D	probably damaging	Het
Muc6	G	C	7: 141,637,746	P2338R	probably damaging	Het
Nbr1	G	A	11: 101,566,200	R163Q	probably damaging	Het
Nlrp4f	A	G	13: 65,194,329	F501L	probably damaging	Het
Nup133	A	C	8: 123,922,414	I563S	probably benign	Het
Oacyl	T	G	18: 65,725,298		probably null	Het
Oog4	CAA	CA	4: 143,437,452		probably null	Het
Plxna2	C	T	1: 194,643,895	R46C	possibly damaging	Het
Ppp1r26	T	A	2: 28,450,737	D126E	probably damaging	Het
Prl6a1	A	T	13: 27,316,299	R84S	possibly damaging	Het
Ptprz1	C	T	6: 23,001,747	Q1279*	probably null	Het
Ptx4	C	T	17: 25,125,192	T472I	possibly damaging	Het
Rabgap1l	A	G	1: 160,700,788	V416A	probably damaging	Het
Rbfox2	A	T	15: 77,105,634	D231E	probably benign	Het
Reln	A	T	5: 22,227,638	F121L	possibly damaging	Het
Rfx7	G	A	9: 72,616,772	V415I	probably benign	Het
Scaf4	A	T	16: 90,230,076	M951K	unknown	Het
Sdf4	T	C	4: 155,996,520		probably null	Het
Sec16a	T	C	2: 26,441,851	T51A	probably damaging	Het
Sema3a	A	G	5: 13,557,041	N281S	probably damaging	Het
Snai2	G	A	16: 14,706,890	V87I	possibly damaging	Het
Synj2	T	A	17: 5,990,239	S197T	possibly damaging	Het
Syt6	A	T	3: 103,587,702	M328L	probably benign	Het
Tdrd12	A	G	7: 35,478,091	V946A	unknown	Het
Trat1	A	T	16: 48,754,294		probably null	Het
Vmn1r75	T	A	7: 11,881,070	I243K	possibly damaging	Het
Vmn2r83	G	A	10: 79,491,937	C793Y	probably damaging	Het
Wnt9a	G	A	11: 59,328,757	G203D	probably damaging	Het
Xrn2	T	C	2: 147,029,756	I366T	probably damaging	Het
Zfp280d	A	G	9: 72,361,942	D787G	possibly damaging	Het
Zfp706	T	C	15: 37,001,925	T53A	probably damaging	Het

Other mutations in Gata6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00567:Gata6	APN	18	11084330	missense	possibly damaging	0.47
IGL01328:Gata6	APN	18	11064530	missense	probably damaging	0.99
IGL02419:Gata6	APN	18	11054220	missense	probably damaging	1.00
Lutsen	UTSW	18	11063059	missense	possibly damaging	0.65
R0538:Gata6	UTSW	18	11064771	missense	probably benign	0.11
R1419:Gata6	UTSW	18	11064706	missense	probably benign	0.42
R2000:Gata6	UTSW	18	11054113	missense	probably benign	0.04
R3113:Gata6	UTSW	18	11063124	missense	probably damaging	1.00
R4765:Gata6	UTSW	18	11054394	missense	probably benign
R4855:Gata6	UTSW	18	11054497	missense	possibly damaging	0.92
R5368:Gata6	UTSW	18	11063059	missense	possibly damaging	0.65
R6805:Gata6	UTSW	18	11054460	missense	possibly damaging	0.83
R7192:Gata6	UTSW	18	11054475	missense	possibly damaging	0.82
R7206:Gata6	UTSW	18	11054850	missense	probably damaging	1.00
R7541:Gata6	UTSW	18	11059108	missense	probably damaging	1.00
R7736:Gata6	UTSW	18	11084379	missense	probably damaging	1.00
R8029:Gata6	UTSW	18	11054944	missense	possibly damaging	0.68
R8251:Gata6	UTSW	18	11054670	missense	probably benign	0.03
R9339:Gata6	UTSW	18	11054520	missense	probably damaging	0.98
R9712:Gata6	UTSW	18	11059064	missense	possibly damaging	0.68
R9753:Gata6	UTSW	18	11064706	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- GCGGGATATTTAAGGAATGCC -3'
(R):5'- TGAAGAGCAACAGGTCCTCC -3'

Sequencing Primer
(F):5'- GAATGCCCTAAACTAGGAGAG -3'
(R):5'- AGGTCCTCCCAAGTCGACAG -3'

Posted On

2019-10-17