Incidental Mutation 'R7502:Cep170'
ID581514
Institutional Source Beutler Lab
Gene Symbol Cep170
Ensembl Gene ENSMUSG00000057335
Gene Namecentrosomal protein 170
Synonyms4933426L22Rik, A330004A13Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001099637.2; MGI:1918348

Is this an essential gene? Possibly essential (E-score: 0.546) question?
Stock #R7502 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location176733653-176814067 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 176756029 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 163 (D163G)
Ref Sequence ENSEMBL: ENSMUSP00000142032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057037] [ENSMUST00000192927] [ENSMUST00000194727] [ENSMUST00000195433] [ENSMUST00000195717]
Predicted Effect probably damaging
Transcript: ENSMUST00000057037
AA Change: D928G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059562
Gene: ENSMUSG00000057335
AA Change: D928G

DomainStartEndE-ValueType
FHA 22 73 1.27e-7 SMART
low complexity region 118 133 N/A INTRINSIC
low complexity region 717 731 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
Pfam:CEP170_C 801 1496 3.3e-264 PFAM
low complexity region 1533 1545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192664
Predicted Effect probably damaging
Transcript: ENSMUST00000192927
AA Change: D163G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142032
Gene: ENSMUSG00000057335
AA Change: D163G

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Pfam:CEP170_C 30 469 3.4e-129 PFAM
Pfam:CEP170_C 449 708 7.4e-102 PFAM
low complexity region 742 754 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194727
AA Change: D928G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141793
Gene: ENSMUSG00000057335
AA Change: D928G

DomainStartEndE-ValueType
FHA 22 73 1.27e-7 SMART
low complexity region 118 133 N/A INTRINSIC
low complexity region 717 731 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
Pfam:CEP170_C 795 1509 8e-260 PFAM
low complexity region 1543 1555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195433
SMART Domains Protein: ENSMUSP00000142108
Gene: ENSMUSG00000057335

DomainStartEndE-ValueType
FHA 22 73 6.1e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000195717
AA Change: D928G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141769
Gene: ENSMUSG00000057335
AA Change: D928G

DomainStartEndE-ValueType
FHA 22 73 1.27e-7 SMART
low complexity region 118 133 N/A INTRINSIC
low complexity region 717 731 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
Pfam:CEP170_C 795 1499 1.8e-261 PFAM
low complexity region 1533 1545 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. During interphase, the encoded protein localizes to the sub-distal appendages of mature centrioles, which are microtubule-based structures thought to help organize centrosomes. During mitosis, the protein associates with spindle microtubules near the centrosomes. The protein interacts with and is phosphorylated by polo-like kinase 1, and functions in maintaining microtubule organization and cell morphology. The human genome contains a putative transcribed pseudogene. Several alternatively spliced transcript variants of this gene have been found, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(29) : Gene trapped(29)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T C 12: 55,304,421 Y172H probably damaging Het
Acan A G 7: 79,094,203 T661A probably damaging Het
Actrt2 T C 4: 154,666,926 Y251C probably benign Het
Adat3 T A 10: 80,606,421 V31D probably damaging Het
Adgrf4 T C 17: 42,669,657 H179R possibly damaging Het
Ahcyl1 A T 3: 107,671,197 Y241* probably null Het
Anks1 C A 17: 28,008,140 T589K possibly damaging Het
Arhgap15 A G 2: 43,780,618 T5A probably benign Het
Cacna1e A T 1: 154,468,988 M1130K probably null Het
Ccdc121 G A 1: 181,510,878 Q170* probably null Het
Ccdc173 A T 2: 69,776,144 D309E probably benign Het
Ceacam18 A T 7: 43,636,874 D57V probably damaging Het
Celf1 C T 2: 91,004,755 Q194* probably null Het
Celsr2 T A 3: 108,398,902 T2029S probably benign Het
Cftr T C 6: 18,214,296 F157S probably damaging Het
Chchd3 T C 6: 32,968,229 E114G probably damaging Het
Cntnap2 T A 6: 46,484,029 S666R possibly damaging Het
Col6a5 C T 9: 105,875,876 V2266I probably benign Het
Ctr9 A G 7: 111,033,926 D127G probably benign Het
Ctsl A T 13: 64,367,068 F141I probably damaging Het
Dcpp1 T A 17: 23,882,641 Y121* probably null Het
Ddx42 T C 11: 106,247,739 V788A probably benign Het
Ehd4 T C 2: 120,091,393 I461V probably benign Het
Elp6 C A 9: 110,305,308 L5I possibly damaging Het
Faap20 T C 4: 155,250,336 S2P Het
Fam98b A C 2: 117,263,863 Y218S probably damaging Het
Fbxl4 T A 4: 22,376,655 D30E probably benign Het
Fcrlb T C 1: 170,908,641 T189A probably damaging Het
Gfpt1 A G 6: 87,066,689 D302G probably benign Het
Gzmg T G 14: 56,156,827 E203D not run Het
Hrasls T C 16: 29,228,167 V146A probably benign Het
Hsph1 A C 5: 149,630,373 V210G probably damaging Het
Il20rb A T 9: 100,468,426 M138K probably damaging Het
Itpr1 A T 6: 108,383,678 E688D probably benign Het
Jmjd1c T G 10: 67,232,015 S1585A probably damaging Het
Kcnk3 A T 5: 30,622,718 T371S possibly damaging Het
Kif11 T A 19: 37,409,807 S694T possibly damaging Het
Kpna7 T A 5: 145,005,921 H85L probably benign Het
Lipf A T 19: 33,976,606 I366F probably damaging Het
Lrrc27 A G 7: 139,214,832 H37R probably benign Het
Mfsd7a G A 5: 108,443,780 probably null Het
Mki67 T C 7: 135,700,783 T841A possibly damaging Het
Mtss1 A G 15: 58,948,361 S120P probably damaging Het
Nav1 A G 1: 135,469,666 W922R probably damaging Het
Nwd1 A G 8: 72,707,393 E1206G probably damaging Het
Obscn T C 11: 58,994,809 S7933G unknown Het
Olfr117 T A 17: 37,660,231 Y34F probably damaging Het
Olfr1263 T C 2: 90,015,011 L27S probably benign Het
Olfr267 T C 4: 58,785,648 I25V probably benign Het
Olfr409-ps1 T C 11: 74,317,184 V53A probably benign Het
Olfr71 T C 4: 43,706,316 H84R probably damaging Het
Otog A T 7: 46,298,615 I162F probably damaging Het
Paf1 G A 7: 28,395,868 V153I possibly damaging Het
Pcdhga11 T A 18: 37,756,501 D187E probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pitrm1 G T 13: 6,560,622 R424L probably damaging Het
Pla2g4e T A 2: 120,174,338 probably null Het
Prrc2a T C 17: 35,162,310 N61S unknown Het
Ror1 T A 4: 100,333,630 D61E probably benign Het
Ryr3 G A 2: 112,712,361 P3168S probably benign Het
Serinc4 T A 2: 121,453,769 I289F probably damaging Het
Sez6l A T 5: 112,475,481 L68H possibly damaging Het
Sez6l2 A G 7: 126,961,743 E460G probably benign Het
Sh3tc1 C T 5: 35,706,062 G927D probably damaging Het
Slc22a27 G C 19: 7,926,382 T130S probably damaging Het
Slc38a8 C A 8: 119,501,081 A37S possibly damaging Het
Slc40a1 T C 1: 45,918,974 N100D probably damaging Het
Snx30 T C 4: 59,894,567 F382L possibly damaging Het
Sox1 A G 8: 12,396,913 N185D possibly damaging Het
Spsb1 C T 4: 149,906,928 R61H possibly damaging Het
Sptbn2 T C 19: 4,748,082 V1945A probably benign Het
St18 T A 1: 6,827,970 N665K probably benign Het
Syne1 A G 10: 5,333,446 S1540P probably damaging Het
Syne2 G A 12: 76,094,326 V1331M probably damaging Het
Tfap2c T C 2: 172,551,719 S185P probably benign Het
Tnfsf8 T A 4: 63,851,161 D71V probably damaging Het
Tnn T C 1: 160,110,359 D1196G probably benign Het
Ttll8 A G 15: 88,933,436 probably null Het
Tubgcp3 A G 8: 12,641,207 F444L probably damaging Het
Txndc11 G A 16: 11,087,878 P596L probably benign Het
Ubr4 C T 4: 139,412,672 P1189S possibly damaging Het
Usp32 T C 11: 85,022,898 D869G possibly damaging Het
Vmn1r202 G T 13: 22,502,018 N76K probably damaging Het
Wfdc6a C T 2: 164,579,841 M132I probably benign Het
Wnk2 A T 13: 49,147,244 probably null Het
Xbp1 A G 11: 5,524,683 probably null Het
Zfp551 A T 7: 12,415,798 Y561* probably null Het
Other mutations in Cep170
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Cep170 APN 1 176755399 missense probably damaging 1.00
IGL00925:Cep170 APN 1 176793524 missense probably damaging 1.00
IGL00972:Cep170 APN 1 176735696 missense probably benign 0.00
IGL01488:Cep170 APN 1 176756375 missense probably benign 0.00
IGL01916:Cep170 APN 1 176739910 splice site probably benign
IGL02212:Cep170 APN 1 176735936 missense probably damaging 0.99
IGL02269:Cep170 APN 1 176769366 missense probably benign
IGL02732:Cep170 APN 1 176736874 missense probably damaging 1.00
IGL02740:Cep170 APN 1 176793600 missense probably damaging 1.00
IGL02812:Cep170 APN 1 176742514 missense probably damaging 1.00
IGL03036:Cep170 APN 1 176769337 missense possibly damaging 0.87
IGL03201:Cep170 APN 1 176736888 missense probably damaging 1.00
IGL03333:Cep170 APN 1 176769526 missense possibly damaging 0.64
PIT4520001:Cep170 UTSW 1 176780199 missense unknown
R0031:Cep170 UTSW 1 176756091 missense probably damaging 1.00
R0039:Cep170 UTSW 1 176782495 critical splice donor site probably null
R0053:Cep170 UTSW 1 176782380 missense possibly damaging 0.82
R0053:Cep170 UTSW 1 176782380 missense possibly damaging 0.82
R0113:Cep170 UTSW 1 176758455 missense probably damaging 0.97
R0144:Cep170 UTSW 1 176792595 missense probably benign 0.01
R0613:Cep170 UTSW 1 176774680 missense probably benign
R0755:Cep170 UTSW 1 176755753 missense probably damaging 1.00
R1132:Cep170 UTSW 1 176750037 missense probably damaging 1.00
R1367:Cep170 UTSW 1 176735724 missense probably damaging 0.99
R1399:Cep170 UTSW 1 176758403 missense probably damaging 0.98
R1462:Cep170 UTSW 1 176756645 missense possibly damaging 0.46
R1462:Cep170 UTSW 1 176756645 missense possibly damaging 0.46
R1481:Cep170 UTSW 1 176782385 missense possibly damaging 0.56
R1526:Cep170 UTSW 1 176788505 missense probably damaging 1.00
R1540:Cep170 UTSW 1 176739932 missense probably damaging 1.00
R1552:Cep170 UTSW 1 176782494 splice site probably benign
R1570:Cep170 UTSW 1 176755801 missense possibly damaging 0.64
R1846:Cep170 UTSW 1 176755769 missense probably damaging 1.00
R1884:Cep170 UTSW 1 176774679 missense probably benign 0.12
R1945:Cep170 UTSW 1 176793534 nonsense probably null
R1954:Cep170 UTSW 1 176756384 missense probably benign
R1957:Cep170 UTSW 1 176769447 missense probably benign 0.24
R2184:Cep170 UTSW 1 176756976 missense probably benign 0.00
R2280:Cep170 UTSW 1 176774505 missense probably benign 0.17
R2426:Cep170 UTSW 1 176774635 missense probably benign
R3415:Cep170 UTSW 1 176756044 missense probably damaging 1.00
R3417:Cep170 UTSW 1 176756044 missense probably damaging 1.00
R3752:Cep170 UTSW 1 176782495 critical splice donor site probably benign
R3848:Cep170 UTSW 1 176755843 missense probably benign 0.14
R3849:Cep170 UTSW 1 176755843 missense probably benign 0.14
R4752:Cep170 UTSW 1 176756688 missense probably benign 0.00
R4910:Cep170 UTSW 1 176782263 missense possibly damaging 0.94
R5007:Cep170 UTSW 1 176769814 missense probably benign 0.28
R5052:Cep170 UTSW 1 176793551 missense probably damaging 1.00
R5093:Cep170 UTSW 1 176769330 missense possibly damaging 0.95
R5530:Cep170 UTSW 1 176769510 missense probably benign 0.00
R5622:Cep170 UTSW 1 176735867 missense possibly damaging 0.64
R5892:Cep170 UTSW 1 176755387 unclassified probably null
R5942:Cep170 UTSW 1 176756419 missense probably damaging 1.00
R6083:Cep170 UTSW 1 176774625 missense probably damaging 1.00
R6091:Cep170 UTSW 1 176755831 missense probably damaging 0.98
R6190:Cep170 UTSW 1 176782409 missense probably damaging 1.00
R6253:Cep170 UTSW 1 176780394 missense possibly damaging 0.71
R6476:Cep170 UTSW 1 176780351 missense possibly damaging 0.72
R6622:Cep170 UTSW 1 176756332 missense probably damaging 1.00
R6932:Cep170 UTSW 1 176761437 missense possibly damaging 0.90
R7030:Cep170 UTSW 1 176756485 missense probably damaging 0.99
R7163:Cep170 UTSW 1 176774465 missense probably damaging 1.00
R7352:Cep170 UTSW 1 176769857 missense probably benign 0.11
R7499:Cep170 UTSW 1 176774462 missense probably damaging 1.00
R7773:Cep170 UTSW 1 176740076 missense
R8043:Cep170 UTSW 1 176769242 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGCACCTATATCTGCAGAGCG -3'
(R):5'- CTTAGCACTGACGTCTGCAAG -3'

Sequencing Primer
(F):5'- CCTATATCTGCAGAGCGGCTTTTTG -3'
(R):5'- TGACGTCTGCAAGTAGACTC -3'
Posted On2019-10-17