Incidental Mutation 'R7502:Kcnk3'
ID581538
Institutional Source Beutler Lab
Gene Symbol Kcnk3
Ensembl Gene ENSMUSG00000049265
Gene Namepotassium channel, subfamily K, member 3
SynonymscTBAK-1, Task-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R7502 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location30588170-30625271 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30622718 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 371 (T371S)
Ref Sequence ENSEMBL: ENSMUSP00000098987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066295]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066295
AA Change: T371S

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098987
Gene: ENSMUSG00000049265
AA Change: T371S

DomainStartEndE-ValueType
transmembrane domain 9 26 N/A INTRINSIC
low complexity region 37 49 N/A INTRINSIC
Pfam:Ion_trans_2 58 134 2.9e-20 PFAM
Pfam:Ion_trans_2 165 248 1.4e-21 PFAM
low complexity region 272 286 N/A INTRINSIC
low complexity region 296 308 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the superfamily of potassium channel proteins that contain two pore-forming P domains. The encoded protein is an outwardly rectifying channel that is sensitive to changes in extracellular pH and is inhibited by extracellular acidification. Also referred to as an acid-sensitive potassium channel, it is activated by the anesthetics halothane and isoflurane. Although three transcripts are detected in northern blots, there is currently no sequence available to confirm transcript variants for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a null alleles exhibit decreased pH sensitivitive of action potential in serotonergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T C 12: 55,304,421 Y172H probably damaging Het
Acan A G 7: 79,094,203 T661A probably damaging Het
Actrt2 T C 4: 154,666,926 Y251C probably benign Het
Adat3 T A 10: 80,606,421 V31D probably damaging Het
Adgrf4 T C 17: 42,669,657 H179R possibly damaging Het
Ahcyl1 A T 3: 107,671,197 Y241* probably null Het
Anks1 C A 17: 28,008,140 T589K possibly damaging Het
Arhgap15 A G 2: 43,780,618 T5A probably benign Het
Cacna1e A T 1: 154,468,988 M1130K probably null Het
Ccdc121 G A 1: 181,510,878 Q170* probably null Het
Ccdc173 A T 2: 69,776,144 D309E probably benign Het
Ceacam18 A T 7: 43,636,874 D57V probably damaging Het
Celf1 C T 2: 91,004,755 Q194* probably null Het
Celsr2 T A 3: 108,398,902 T2029S probably benign Het
Cep170 T C 1: 176,756,029 D163G probably damaging Het
Cftr T C 6: 18,214,296 F157S probably damaging Het
Chchd3 T C 6: 32,968,229 E114G probably damaging Het
Cntnap2 T A 6: 46,484,029 S666R possibly damaging Het
Col6a5 C T 9: 105,875,876 V2266I probably benign Het
Ctr9 A G 7: 111,033,926 D127G probably benign Het
Ctsl A T 13: 64,367,068 F141I probably damaging Het
Dcpp1 T A 17: 23,882,641 Y121* probably null Het
Ddx42 T C 11: 106,247,739 V788A probably benign Het
Ehd4 T C 2: 120,091,393 I461V probably benign Het
Elp6 C A 9: 110,305,308 L5I possibly damaging Het
Faap20 T C 4: 155,250,336 S2P Het
Fam98b A C 2: 117,263,863 Y218S probably damaging Het
Fbxl4 T A 4: 22,376,655 D30E probably benign Het
Fcrlb T C 1: 170,908,641 T189A probably damaging Het
Gfpt1 A G 6: 87,066,689 D302G probably benign Het
Gzmg T G 14: 56,156,827 E203D not run Het
Hrasls T C 16: 29,228,167 V146A probably benign Het
Hsph1 A C 5: 149,630,373 V210G probably damaging Het
Il20rb A T 9: 100,468,426 M138K probably damaging Het
Itpr1 A T 6: 108,383,678 E688D probably benign Het
Jmjd1c T G 10: 67,232,015 S1585A probably damaging Het
Kif11 T A 19: 37,409,807 S694T possibly damaging Het
Kpna7 T A 5: 145,005,921 H85L probably benign Het
Lipf A T 19: 33,976,606 I366F probably damaging Het
Lrrc27 A G 7: 139,214,832 H37R probably benign Het
Mfsd7a G A 5: 108,443,780 probably null Het
Mki67 T C 7: 135,700,783 T841A possibly damaging Het
Mtss1 A G 15: 58,948,361 S120P probably damaging Het
Nav1 A G 1: 135,469,666 W922R probably damaging Het
Nwd1 A G 8: 72,707,393 E1206G probably damaging Het
Obscn T C 11: 58,994,809 S7933G unknown Het
Olfr117 T A 17: 37,660,231 Y34F probably damaging Het
Olfr1263 T C 2: 90,015,011 L27S probably benign Het
Olfr267 T C 4: 58,785,648 I25V probably benign Het
Olfr409-ps1 T C 11: 74,317,184 V53A probably benign Het
Olfr71 T C 4: 43,706,316 H84R probably damaging Het
Otog A T 7: 46,298,615 I162F probably damaging Het
Paf1 G A 7: 28,395,868 V153I possibly damaging Het
Pcdhga11 T A 18: 37,756,501 D187E probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pitrm1 G T 13: 6,560,622 R424L probably damaging Het
Pla2g4e T A 2: 120,174,338 probably null Het
Prrc2a T C 17: 35,162,310 N61S unknown Het
Ror1 T A 4: 100,333,630 D61E probably benign Het
Ryr3 G A 2: 112,712,361 P3168S probably benign Het
Serinc4 T A 2: 121,453,769 I289F probably damaging Het
Sez6l A T 5: 112,475,481 L68H possibly damaging Het
Sez6l2 A G 7: 126,961,743 E460G probably benign Het
Sh3tc1 C T 5: 35,706,062 G927D probably damaging Het
Slc22a27 G C 19: 7,926,382 T130S probably damaging Het
Slc38a8 C A 8: 119,501,081 A37S possibly damaging Het
Slc40a1 T C 1: 45,918,974 N100D probably damaging Het
Snx30 T C 4: 59,894,567 F382L possibly damaging Het
Sox1 A G 8: 12,396,913 N185D possibly damaging Het
Spsb1 C T 4: 149,906,928 R61H possibly damaging Het
Sptbn2 T C 19: 4,748,082 V1945A probably benign Het
St18 T A 1: 6,827,970 N665K probably benign Het
Syne1 A G 10: 5,333,446 S1540P probably damaging Het
Syne2 G A 12: 76,094,326 V1331M probably damaging Het
Tfap2c T C 2: 172,551,719 S185P probably benign Het
Tnfsf8 T A 4: 63,851,161 D71V probably damaging Het
Tnn T C 1: 160,110,359 D1196G probably benign Het
Ttll8 A G 15: 88,933,436 probably null Het
Tubgcp3 A G 8: 12,641,207 F444L probably damaging Het
Txndc11 G A 16: 11,087,878 P596L probably benign Het
Ubr4 C T 4: 139,412,672 P1189S possibly damaging Het
Usp32 T C 11: 85,022,898 D869G possibly damaging Het
Vmn1r202 G T 13: 22,502,018 N76K probably damaging Het
Wfdc6a C T 2: 164,579,841 M132I probably benign Het
Wnk2 A T 13: 49,147,244 probably null Het
Xbp1 A G 11: 5,524,683 probably null Het
Zfp551 A T 7: 12,415,798 Y561* probably null Het
Other mutations in Kcnk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02481:Kcnk3 APN 5 30622383 missense probably damaging 0.99
IGL02719:Kcnk3 APN 5 30621980 missense probably damaging 1.00
PIT4802001:Kcnk3 UTSW 5 30622368 missense probably damaging 1.00
R0288:Kcnk3 UTSW 5 30588420 missense probably benign
R0834:Kcnk3 UTSW 5 30622635 missense probably damaging 1.00
R1740:Kcnk3 UTSW 5 30621977 missense possibly damaging 0.95
R2656:Kcnk3 UTSW 5 30622671 missense possibly damaging 0.55
R2923:Kcnk3 UTSW 5 30622070 missense probably damaging 1.00
R3740:Kcnk3 UTSW 5 30621930 missense possibly damaging 0.93
R4584:Kcnk3 UTSW 5 30588386 missense probably damaging 0.99
R5010:Kcnk3 UTSW 5 30622805 missense possibly damaging 0.79
R5070:Kcnk3 UTSW 5 30622386 missense possibly damaging 0.77
R5427:Kcnk3 UTSW 5 30622295 missense possibly damaging 0.86
R5669:Kcnk3 UTSW 5 30622349 missense probably damaging 0.99
R5956:Kcnk3 UTSW 5 30588510 missense probably damaging 1.00
R5982:Kcnk3 UTSW 5 30622670 missense probably benign 0.18
R5986:Kcnk3 UTSW 5 30588378 missense possibly damaging 0.68
R6318:Kcnk3 UTSW 5 30622586 missense probably damaging 0.98
R6860:Kcnk3 UTSW 5 30622053 missense possibly damaging 0.86
R6919:Kcnk3 UTSW 5 30622400 missense probably benign 0.00
R7350:Kcnk3 UTSW 5 30621966 missense probably damaging 1.00
R7418:Kcnk3 UTSW 5 30622331 missense possibly damaging 0.57
Z1177:Kcnk3 UTSW 5 30588274 start gained probably benign
Z1177:Kcnk3 UTSW 5 30622493 missense probably benign
Z1177:Kcnk3 UTSW 5 30622704 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TCATGACCATGAACGCCGAG -3'
(R):5'- TGATAGCCTGCACAGTTGGAG -3'

Sequencing Primer
(F):5'- GGCTTCCGCAACGTCTATG -3'
(R):5'- ATAGCCTGCACAGTTGGAGATTTAG -3'
Posted On2019-10-17