Incidental Mutation 'R7502:Cntnap2'
ID 581546
Institutional Source Beutler Lab
Gene Symbol Cntnap2
Ensembl Gene ENSMUSG00000039419
Gene Name contactin associated protein-like 2
Synonyms 5430425M22Rik, Caspr2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7502 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 45059357-47304213 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 46484029 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 666 (S666R)
Ref Sequence ENSEMBL: ENSMUSP00000110288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114641]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000114641
AA Change: S666R

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: S666R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 34 181 3.99e-22 SMART
LamG 208 345 5.5e-34 SMART
LamG 393 529 3.31e-28 SMART
EGF 557 591 5.04e-2 SMART
Blast:FBG 594 777 7e-68 BLAST
LamG 819 945 5.58e-35 SMART
EGF 966 1002 2.11e1 SMART
LamG 1048 1188 3.55e-28 SMART
low complexity region 1263 1273 N/A INTRINSIC
4.1m 1283 1301 4.21e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T C 12: 55,304,421 Y172H probably damaging Het
Acan A G 7: 79,094,203 T661A probably damaging Het
Actrt2 T C 4: 154,666,926 Y251C probably benign Het
Adat3 T A 10: 80,606,421 V31D probably damaging Het
Adgrf4 T C 17: 42,669,657 H179R possibly damaging Het
Ahcyl1 A T 3: 107,671,197 Y241* probably null Het
Anks1 C A 17: 28,008,140 T589K possibly damaging Het
Arhgap15 A G 2: 43,780,618 T5A probably benign Het
Cacna1e A T 1: 154,468,988 M1130K probably null Het
Ccdc121 G A 1: 181,510,878 Q170* probably null Het
Ccdc173 A T 2: 69,776,144 D309E probably benign Het
Ceacam18 A T 7: 43,636,874 D57V probably damaging Het
Celf1 C T 2: 91,004,755 Q194* probably null Het
Celsr2 T A 3: 108,398,902 T2029S probably benign Het
Cep170 T C 1: 176,756,029 D163G probably damaging Het
Cftr T C 6: 18,214,296 F157S probably damaging Het
Chchd3 T C 6: 32,968,229 E114G probably damaging Het
Col6a5 C T 9: 105,875,876 V2266I probably benign Het
Ctr9 A G 7: 111,033,926 D127G probably benign Het
Ctsl A T 13: 64,367,068 F141I probably damaging Het
Dcpp1 T A 17: 23,882,641 Y121* probably null Het
Ddx42 T C 11: 106,247,739 V788A probably benign Het
Ehd4 T C 2: 120,091,393 I461V probably benign Het
Elp6 C A 9: 110,305,308 L5I possibly damaging Het
Faap20 T C 4: 155,250,336 S2P Het
Fam98b A C 2: 117,263,863 Y218S probably damaging Het
Fbxl4 T A 4: 22,376,655 D30E probably benign Het
Fcrlb T C 1: 170,908,641 T189A probably damaging Het
Gfpt1 A G 6: 87,066,689 D302G probably benign Het
Gzmg T G 14: 56,156,827 E203D not run Het
Hrasls T C 16: 29,228,167 V146A probably benign Het
Hsph1 A C 5: 149,630,373 V210G probably damaging Het
Il20rb A T 9: 100,468,426 M138K probably damaging Het
Itpr1 A T 6: 108,383,678 E688D probably benign Het
Jmjd1c T G 10: 67,232,015 S1585A probably damaging Het
Kcnk3 A T 5: 30,622,718 T371S possibly damaging Het
Kif11 T A 19: 37,409,807 S694T possibly damaging Het
Kpna7 T A 5: 145,005,921 H85L probably benign Het
Lipf A T 19: 33,976,606 I366F probably damaging Het
Lrrc27 A G 7: 139,214,832 H37R probably benign Het
Mfsd7a G A 5: 108,443,780 probably null Het
Mki67 T C 7: 135,700,783 T841A possibly damaging Het
Mtss1 A G 15: 58,948,361 S120P probably damaging Het
Nav1 A G 1: 135,469,666 W922R probably damaging Het
Nwd1 A G 8: 72,707,393 E1206G probably damaging Het
Obscn T C 11: 58,994,809 S7933G unknown Het
Olfr117 T A 17: 37,660,231 Y34F probably damaging Het
Olfr1263 T C 2: 90,015,011 L27S probably benign Het
Olfr267 T C 4: 58,785,648 I25V probably benign Het
Olfr409-ps1 T C 11: 74,317,184 V53A probably benign Het
Olfr71 T C 4: 43,706,316 H84R probably damaging Het
Otog A T 7: 46,298,615 I162F probably damaging Het
Paf1 G A 7: 28,395,868 V153I possibly damaging Het
Pcdhga11 T A 18: 37,756,501 D187E probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pitrm1 G T 13: 6,560,622 R424L probably damaging Het
Pla2g4e T A 2: 120,174,338 probably null Het
Prrc2a T C 17: 35,162,310 N61S unknown Het
Ror1 T A 4: 100,333,630 D61E probably benign Het
Ryr3 G A 2: 112,712,361 P3168S probably benign Het
Serinc4 T A 2: 121,453,769 I289F probably damaging Het
Sez6l A T 5: 112,475,481 L68H possibly damaging Het
Sez6l2 A G 7: 126,961,743 E460G probably benign Het
Sh3tc1 C T 5: 35,706,062 G927D probably damaging Het
Slc22a27 G C 19: 7,926,382 T130S probably damaging Het
Slc38a8 C A 8: 119,501,081 A37S possibly damaging Het
Slc40a1 T C 1: 45,918,974 N100D probably damaging Het
Snx30 T C 4: 59,894,567 F382L possibly damaging Het
Sox1 A G 8: 12,396,913 N185D possibly damaging Het
Spsb1 C T 4: 149,906,928 R61H possibly damaging Het
Sptbn2 T C 19: 4,748,082 V1945A probably benign Het
St18 T A 1: 6,827,970 N665K probably benign Het
Syne1 A G 10: 5,333,446 S1540P probably damaging Het
Syne2 G A 12: 76,094,326 V1331M probably damaging Het
Tfap2c T C 2: 172,551,719 S185P probably benign Het
Tnfsf8 T A 4: 63,851,161 D71V probably damaging Het
Tnn T C 1: 160,110,359 D1196G probably benign Het
Ttll8 A G 15: 88,933,436 probably null Het
Tubgcp3 A G 8: 12,641,207 F444L probably damaging Het
Txndc11 G A 16: 11,087,878 P596L probably benign Het
Ubr4 C T 4: 139,412,672 P1189S possibly damaging Het
Usp32 T C 11: 85,022,898 D869G possibly damaging Het
Vmn1r202 G T 13: 22,502,018 N76K probably damaging Het
Wfdc6a C T 2: 164,579,841 M132I probably benign Het
Wnk2 A T 13: 49,147,244 probably null Het
Xbp1 A G 11: 5,524,683 probably null Het
Zfp551 A T 7: 12,415,798 Y561* probably null Het
Other mutations in Cntnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cntnap2 APN 6 46015263 missense possibly damaging 0.92
IGL00657:Cntnap2 APN 6 46988787 missense probably damaging 0.98
IGL00846:Cntnap2 APN 6 47193038 missense probably benign 0.12
IGL00851:Cntnap2 APN 6 46484072 missense probably benign
IGL00857:Cntnap2 APN 6 47049424 missense probably benign 0.00
IGL01290:Cntnap2 APN 6 46015465 missense probably benign 0.06
IGL01445:Cntnap2 APN 6 47193013 missense probably benign 0.14
IGL01468:Cntnap2 APN 6 47271371 nonsense probably null
IGL01859:Cntnap2 APN 6 46988721 missense probably damaging 1.00
IGL02092:Cntnap2 APN 6 46234203 missense probably damaging 1.00
IGL02239:Cntnap2 APN 6 47021654 missense probably damaging 0.99
IGL02508:Cntnap2 APN 6 46234320 missense probably damaging 1.00
IGL02530:Cntnap2 APN 6 47021736 missense possibly damaging 0.48
IGL03013:Cntnap2 APN 6 47095549 missense possibly damaging 0.66
BB004:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
BB014:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
IGL02802:Cntnap2 UTSW 6 46170245 missense probably damaging 1.00
R0001:Cntnap2 UTSW 6 46530171 missense probably benign 0.04
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0043:Cntnap2 UTSW 6 46483983 missense probably benign 0.01
R0118:Cntnap2 UTSW 6 45060392 splice site probably null
R0352:Cntnap2 UTSW 6 45992084 splice site probably null
R0389:Cntnap2 UTSW 6 46009637 missense probably benign 0.06
R0482:Cntnap2 UTSW 6 45715816 missense probably benign 0.00
R0530:Cntnap2 UTSW 6 46529905 nonsense probably null
R0611:Cntnap2 UTSW 6 47095549 missense possibly damaging 0.66
R0630:Cntnap2 UTSW 6 46988760 missense probably damaging 0.99
R0636:Cntnap2 UTSW 6 47296708 splice site probably benign
R0976:Cntnap2 UTSW 6 47271230 missense probably damaging 1.00
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1387:Cntnap2 UTSW 6 47107914 missense probably benign 0.19
R1524:Cntnap2 UTSW 6 46530679 missense probably damaging 1.00
R1609:Cntnap2 UTSW 6 46015330 missense probably benign 0.13
R1716:Cntnap2 UTSW 6 47107892 nonsense probably null
R1757:Cntnap2 UTSW 6 46759829 missense probably damaging 1.00
R1809:Cntnap2 UTSW 6 46988675 missense probably damaging 0.99
R1813:Cntnap2 UTSW 6 46530633 missense probably damaging 1.00
R2103:Cntnap2 UTSW 6 47298588 missense probably damaging 1.00
R2133:Cntnap2 UTSW 6 47298445 missense probably damaging 1.00
R3037:Cntnap2 UTSW 6 46015266 missense possibly damaging 0.57
R3899:Cntnap2 UTSW 6 45991903 missense probably benign 0.00
R4027:Cntnap2 UTSW 6 46856128 missense probably benign
R4030:Cntnap2 UTSW 6 46856128 missense probably benign
R4237:Cntnap2 UTSW 6 46530390 intron probably benign
R4445:Cntnap2 UTSW 6 46759851 missense probably benign 0.01
R4737:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4740:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4915:Cntnap2 UTSW 6 46530035 intron probably benign
R4918:Cntnap2 UTSW 6 46530035 intron probably benign
R4999:Cntnap2 UTSW 6 45920834 missense probably damaging 0.96
R5373:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5374:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5742:Cntnap2 UTSW 6 45920926 nonsense probably null
R5748:Cntnap2 UTSW 6 45715884 missense probably damaging 1.00
R5765:Cntnap2 UTSW 6 46529815 intron probably benign
R6118:Cntnap2 UTSW 6 47193077 missense possibly damaging 0.81
R6181:Cntnap2 UTSW 6 46759808 missense probably damaging 1.00
R6189:Cntnap2 UTSW 6 47271298 missense probably damaging 1.00
R6262:Cntnap2 UTSW 6 45060112 splice site probably null
R6385:Cntnap2 UTSW 6 46856180 missense probably benign 0.00
R6555:Cntnap2 UTSW 6 46759760 missense probably damaging 1.00
R6577:Cntnap2 UTSW 6 46170272 missense probably benign 0.25
R6610:Cntnap2 UTSW 6 46015257 missense probably benign 0.08
R6761:Cntnap2 UTSW 6 47049373 missense probably benign 0.03
R7125:Cntnap2 UTSW 6 46988646 missense probably benign 0.12
R7329:Cntnap2 UTSW 6 47271271 missense possibly damaging 0.94
R7927:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
R8057:Cntnap2 UTSW 6 46347145 missense probably damaging 0.98
R8261:Cntnap2 UTSW 6 47095693 missense probably damaging 0.98
R8356:Cntnap2 UTSW 6 47049373 missense probably benign 0.03
R8479:Cntnap2 UTSW 6 46759773 missense probably benign 0.14
R8503:Cntnap2 UTSW 6 45992041 missense probably damaging 1.00
R8698:Cntnap2 UTSW 6 47049222 missense probably damaging 1.00
R8719:Cntnap2 UTSW 6 46001227 missense probably damaging 1.00
R8816:Cntnap2 UTSW 6 46856142 missense possibly damaging 0.72
R8987:Cntnap2 UTSW 6 46484049 missense probably benign 0.01
R9000:Cntnap2 UTSW 6 46484205 intron probably benign
R9209:Cntnap2 UTSW 6 47049249 missense probably damaging 1.00
R9253:Cntnap2 UTSW 6 46001178 missense probably benign 0.00
R9310:Cntnap2 UTSW 6 46001347 missense probably damaging 1.00
R9395:Cntnap2 UTSW 6 46001310 missense probably damaging 0.98
R9462:Cntnap2 UTSW 6 46234283 missense probably damaging 0.99
R9526:Cntnap2 UTSW 6 46015231 missense probably damaging 1.00
R9600:Cntnap2 UTSW 6 45992075 missense probably damaging 0.98
R9621:Cntnap2 UTSW 6 46988792 missense probably damaging 0.98
R9738:Cntnap2 UTSW 6 46015439 frame shift probably null
R9745:Cntnap2 UTSW 6 46234166 missense probably benign 0.01
R9775:Cntnap2 UTSW 6 47049327 missense probably damaging 1.00
RF022:Cntnap2 UTSW 6 47021665 missense probably damaging 1.00
X0018:Cntnap2 UTSW 6 46009518 missense possibly damaging 0.53
X0063:Cntnap2 UTSW 6 47021754 missense possibly damaging 0.92
X0066:Cntnap2 UTSW 6 46234245 missense probably benign 0.03
Z1176:Cntnap2 UTSW 6 47271148 missense probably benign 0.00
Z1177:Cntnap2 UTSW 6 46015299 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GATTGCTCCCTCTAACTCGG -3'
(R):5'- TAATAAGCCACACCTGTTGGG -3'

Sequencing Primer
(F):5'- AACTCGGTTTTATTCCAGTCTAATG -3'
(R):5'- GGGTTGTTTAGGCAATTGCAAACAC -3'
Posted On 2019-10-17