Incidental Mutation 'R7502:Cntnap2'
ID 581546
Institutional Source Beutler Lab
Gene Symbol Cntnap2
Ensembl Gene ENSMUSG00000039419
Gene Name contactin associated protein-like 2
Synonyms Caspr2, 5430425M22Rik
MMRRC Submission 045575-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7502 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 45036995-47278330 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 46460963 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 666 (S666R)
Ref Sequence ENSEMBL: ENSMUSP00000110288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114641]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000114641
AA Change: S666R

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: S666R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 34 181 3.99e-22 SMART
LamG 208 345 5.5e-34 SMART
LamG 393 529 3.31e-28 SMART
EGF 557 591 5.04e-2 SMART
Blast:FBG 594 777 7e-68 BLAST
LamG 819 945 5.58e-35 SMART
EGF 966 1002 2.11e1 SMART
LamG 1048 1188 3.55e-28 SMART
low complexity region 1263 1273 N/A INTRINSIC
4.1m 1283 1301 4.21e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 78,743,951 (GRCm39) T661A probably damaging Het
Actrt2 T C 4: 154,751,383 (GRCm39) Y251C probably benign Het
Adat3 T A 10: 80,442,255 (GRCm39) V31D probably damaging Het
Adgrf4 T C 17: 42,980,548 (GRCm39) H179R possibly damaging Het
Ahcyl1 A T 3: 107,578,513 (GRCm39) Y241* probably null Het
Anks1 C A 17: 28,227,114 (GRCm39) T589K possibly damaging Het
Arhgap15 A G 2: 43,670,630 (GRCm39) T5A probably benign Het
Cacna1e A T 1: 154,344,734 (GRCm39) M1130K probably null Het
Ccdc121rt1 G A 1: 181,338,443 (GRCm39) Q170* probably null Het
Ceacam18 A T 7: 43,286,298 (GRCm39) D57V probably damaging Het
Celf1 C T 2: 90,835,100 (GRCm39) Q194* probably null Het
Celsr2 T A 3: 108,306,218 (GRCm39) T2029S probably benign Het
Cep170 T C 1: 176,583,595 (GRCm39) D163G probably damaging Het
Cfap210 A T 2: 69,606,488 (GRCm39) D309E probably benign Het
Cftr T C 6: 18,214,295 (GRCm39) F157S probably damaging Het
Chchd3 T C 6: 32,945,164 (GRCm39) E114G probably damaging Het
Col6a5 C T 9: 105,753,075 (GRCm39) V2266I probably benign Het
Ctr9 A G 7: 110,633,133 (GRCm39) D127G probably benign Het
Ctsl A T 13: 64,514,882 (GRCm39) F141I probably damaging Het
Dcpp1 T A 17: 24,101,615 (GRCm39) Y121* probably null Het
Ddx42 T C 11: 106,138,565 (GRCm39) V788A probably benign Het
Ehd4 T C 2: 119,921,874 (GRCm39) I461V probably benign Het
Elp6 C A 9: 110,134,376 (GRCm39) L5I possibly damaging Het
Faap20 T C 4: 155,334,793 (GRCm39) S2P Het
Fam98b A C 2: 117,094,344 (GRCm39) Y218S probably damaging Het
Fbxl4 T A 4: 22,376,655 (GRCm39) D30E probably benign Het
Fcrlb T C 1: 170,736,210 (GRCm39) T189A probably damaging Het
Gfpt1 A G 6: 87,043,671 (GRCm39) D302G probably benign Het
Gzmg T G 14: 56,394,284 (GRCm39) E203D not run Het
Hsph1 A C 5: 149,553,838 (GRCm39) V210G probably damaging Het
Il20rb A T 9: 100,350,479 (GRCm39) M138K probably damaging Het
Itpr1 A T 6: 108,360,639 (GRCm39) E688D probably benign Het
Jmjd1c T G 10: 67,067,794 (GRCm39) S1585A probably damaging Het
Kcnk3 A T 5: 30,780,062 (GRCm39) T371S possibly damaging Het
Kif11 T A 19: 37,398,255 (GRCm39) S694T possibly damaging Het
Kpna7 T A 5: 144,942,731 (GRCm39) H85L probably benign Het
Lipf A T 19: 33,954,006 (GRCm39) I366F probably damaging Het
Lrrc27 A G 7: 138,794,748 (GRCm39) H37R probably benign Het
Mki67 T C 7: 135,302,512 (GRCm39) T841A possibly damaging Het
Mtss1 A G 15: 58,820,210 (GRCm39) S120P probably damaging Het
Nav1 A G 1: 135,397,404 (GRCm39) W922R probably damaging Het
Nwd1 A G 8: 73,434,021 (GRCm39) E1206G probably damaging Het
Obscn T C 11: 58,885,635 (GRCm39) S7933G unknown Het
Or13j1 T C 4: 43,706,316 (GRCm39) H84R probably damaging Het
Or1p4-ps1 T C 11: 74,208,010 (GRCm39) V53A probably benign Het
Or2g25 T A 17: 37,971,122 (GRCm39) Y34F probably damaging Het
Or2k2 T C 4: 58,785,648 (GRCm39) I25V probably benign Het
Or4c52 T C 2: 89,845,355 (GRCm39) L27S probably benign Het
Otog A T 7: 45,948,039 (GRCm39) I162F probably damaging Het
Paf1 G A 7: 28,095,293 (GRCm39) V153I possibly damaging Het
Pcdhga11 T A 18: 37,889,554 (GRCm39) D187E probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pitrm1 G T 13: 6,610,658 (GRCm39) R424L probably damaging Het
Pla2g4e T A 2: 120,004,819 (GRCm39) probably null Het
Plaat1 T C 16: 29,046,919 (GRCm39) V146A probably benign Het
Prorp T C 12: 55,351,206 (GRCm39) Y172H probably damaging Het
Prrc2a T C 17: 35,381,286 (GRCm39) N61S unknown Het
Ror1 T A 4: 100,190,827 (GRCm39) D61E probably benign Het
Ryr3 G A 2: 112,542,706 (GRCm39) P3168S probably benign Het
Serinc4 T A 2: 121,284,250 (GRCm39) I289F probably damaging Het
Sez6l A T 5: 112,623,347 (GRCm39) L68H possibly damaging Het
Sez6l2 A G 7: 126,560,915 (GRCm39) E460G probably benign Het
Sh3tc1 C T 5: 35,863,406 (GRCm39) G927D probably damaging Het
Slc22a27 G C 19: 7,903,747 (GRCm39) T130S probably damaging Het
Slc38a8 C A 8: 120,227,820 (GRCm39) A37S possibly damaging Het
Slc40a1 T C 1: 45,958,134 (GRCm39) N100D probably damaging Het
Slc49a3 G A 5: 108,591,646 (GRCm39) probably null Het
Snx30 T C 4: 59,894,567 (GRCm39) F382L possibly damaging Het
Sox1 A G 8: 12,446,913 (GRCm39) N185D possibly damaging Het
Spsb1 C T 4: 149,991,385 (GRCm39) R61H possibly damaging Het
Sptbn2 T C 19: 4,798,110 (GRCm39) V1945A probably benign Het
St18 T A 1: 6,898,194 (GRCm39) N665K probably benign Het
Syne1 A G 10: 5,283,446 (GRCm39) S1540P probably damaging Het
Syne2 G A 12: 76,141,100 (GRCm39) V1331M probably damaging Het
Tfap2c T C 2: 172,393,639 (GRCm39) S185P probably benign Het
Tnfsf8 T A 4: 63,769,398 (GRCm39) D71V probably damaging Het
Tnn T C 1: 159,937,929 (GRCm39) D1196G probably benign Het
Ttll8 A G 15: 88,817,639 (GRCm39) probably null Het
Tubgcp3 A G 8: 12,691,207 (GRCm39) F444L probably damaging Het
Txndc11 G A 16: 10,905,742 (GRCm39) P596L probably benign Het
Ubr4 C T 4: 139,139,983 (GRCm39) P1189S possibly damaging Het
Usp32 T C 11: 84,913,724 (GRCm39) D869G possibly damaging Het
Vmn1r202 G T 13: 22,686,188 (GRCm39) N76K probably damaging Het
Wfdc6a C T 2: 164,421,761 (GRCm39) M132I probably benign Het
Wnk2 A T 13: 49,300,720 (GRCm39) probably null Het
Xbp1 A G 11: 5,474,683 (GRCm39) probably null Het
Zfp551 A T 7: 12,149,725 (GRCm39) Y561* probably null Het
Other mutations in Cntnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cntnap2 APN 6 45,992,197 (GRCm39) missense possibly damaging 0.92
IGL00657:Cntnap2 APN 6 46,965,721 (GRCm39) missense probably damaging 0.98
IGL00846:Cntnap2 APN 6 47,169,972 (GRCm39) missense probably benign 0.12
IGL00851:Cntnap2 APN 6 46,461,006 (GRCm39) missense probably benign
IGL00857:Cntnap2 APN 6 47,026,358 (GRCm39) missense probably benign 0.00
IGL01290:Cntnap2 APN 6 45,992,399 (GRCm39) missense probably benign 0.06
IGL01445:Cntnap2 APN 6 47,169,947 (GRCm39) missense probably benign 0.14
IGL01468:Cntnap2 APN 6 47,248,305 (GRCm39) nonsense probably null
IGL01859:Cntnap2 APN 6 46,965,655 (GRCm39) missense probably damaging 1.00
IGL02092:Cntnap2 APN 6 46,211,137 (GRCm39) missense probably damaging 1.00
IGL02239:Cntnap2 APN 6 46,998,588 (GRCm39) missense probably damaging 0.99
IGL02508:Cntnap2 APN 6 46,211,254 (GRCm39) missense probably damaging 1.00
IGL02530:Cntnap2 APN 6 46,998,670 (GRCm39) missense possibly damaging 0.48
IGL03013:Cntnap2 APN 6 47,072,483 (GRCm39) missense possibly damaging 0.66
BB004:Cntnap2 UTSW 6 47,072,621 (GRCm39) missense possibly damaging 0.93
BB014:Cntnap2 UTSW 6 47,072,621 (GRCm39) missense possibly damaging 0.93
IGL02802:Cntnap2 UTSW 6 46,147,179 (GRCm39) missense probably damaging 1.00
R0001:Cntnap2 UTSW 6 46,507,105 (GRCm39) missense probably benign 0.04
R0007:Cntnap2 UTSW 6 45,969,007 (GRCm39) missense possibly damaging 0.95
R0007:Cntnap2 UTSW 6 45,969,007 (GRCm39) missense possibly damaging 0.95
R0043:Cntnap2 UTSW 6 46,460,917 (GRCm39) missense probably benign 0.01
R0118:Cntnap2 UTSW 6 45,037,326 (GRCm39) splice site probably null
R0352:Cntnap2 UTSW 6 45,969,018 (GRCm39) splice site probably null
R0389:Cntnap2 UTSW 6 45,986,571 (GRCm39) missense probably benign 0.06
R0482:Cntnap2 UTSW 6 45,692,750 (GRCm39) missense probably benign 0.00
R0530:Cntnap2 UTSW 6 46,506,839 (GRCm39) nonsense probably null
R0611:Cntnap2 UTSW 6 47,072,483 (GRCm39) missense possibly damaging 0.66
R0630:Cntnap2 UTSW 6 46,965,694 (GRCm39) missense probably damaging 0.99
R0636:Cntnap2 UTSW 6 47,273,642 (GRCm39) splice site probably benign
R0976:Cntnap2 UTSW 6 47,248,164 (GRCm39) missense probably damaging 1.00
R1195:Cntnap2 UTSW 6 46,460,902 (GRCm39) missense probably benign
R1195:Cntnap2 UTSW 6 46,460,902 (GRCm39) missense probably benign
R1195:Cntnap2 UTSW 6 46,460,902 (GRCm39) missense probably benign
R1387:Cntnap2 UTSW 6 47,084,848 (GRCm39) missense probably benign 0.19
R1524:Cntnap2 UTSW 6 46,507,613 (GRCm39) missense probably damaging 1.00
R1609:Cntnap2 UTSW 6 45,992,264 (GRCm39) missense probably benign 0.13
R1716:Cntnap2 UTSW 6 47,084,826 (GRCm39) nonsense probably null
R1757:Cntnap2 UTSW 6 46,736,763 (GRCm39) missense probably damaging 1.00
R1809:Cntnap2 UTSW 6 46,965,609 (GRCm39) missense probably damaging 0.99
R1813:Cntnap2 UTSW 6 46,507,567 (GRCm39) missense probably damaging 1.00
R2103:Cntnap2 UTSW 6 47,275,522 (GRCm39) missense probably damaging 1.00
R2133:Cntnap2 UTSW 6 47,275,379 (GRCm39) missense probably damaging 1.00
R3037:Cntnap2 UTSW 6 45,992,200 (GRCm39) missense possibly damaging 0.57
R3899:Cntnap2 UTSW 6 45,968,837 (GRCm39) missense probably benign 0.00
R4027:Cntnap2 UTSW 6 46,833,062 (GRCm39) missense probably benign
R4030:Cntnap2 UTSW 6 46,833,062 (GRCm39) missense probably benign
R4237:Cntnap2 UTSW 6 46,507,324 (GRCm39) intron probably benign
R4445:Cntnap2 UTSW 6 46,736,785 (GRCm39) missense probably benign 0.01
R4737:Cntnap2 UTSW 6 45,037,251 (GRCm39) missense possibly damaging 0.65
R4740:Cntnap2 UTSW 6 45,037,251 (GRCm39) missense possibly damaging 0.65
R4915:Cntnap2 UTSW 6 46,506,969 (GRCm39) intron probably benign
R4918:Cntnap2 UTSW 6 46,506,969 (GRCm39) intron probably benign
R4999:Cntnap2 UTSW 6 45,897,768 (GRCm39) missense probably damaging 0.96
R5373:Cntnap2 UTSW 6 47,084,903 (GRCm39) missense probably benign 0.00
R5374:Cntnap2 UTSW 6 47,084,903 (GRCm39) missense probably benign 0.00
R5742:Cntnap2 UTSW 6 45,897,860 (GRCm39) nonsense probably null
R5748:Cntnap2 UTSW 6 45,692,818 (GRCm39) missense probably damaging 1.00
R5765:Cntnap2 UTSW 6 46,506,749 (GRCm39) intron probably benign
R6118:Cntnap2 UTSW 6 47,170,011 (GRCm39) missense possibly damaging 0.81
R6181:Cntnap2 UTSW 6 46,736,742 (GRCm39) missense probably damaging 1.00
R6189:Cntnap2 UTSW 6 47,248,232 (GRCm39) missense probably damaging 1.00
R6262:Cntnap2 UTSW 6 45,037,046 (GRCm39) splice site probably null
R6385:Cntnap2 UTSW 6 46,833,114 (GRCm39) missense probably benign 0.00
R6555:Cntnap2 UTSW 6 46,736,694 (GRCm39) missense probably damaging 1.00
R6577:Cntnap2 UTSW 6 46,147,206 (GRCm39) missense probably benign 0.25
R6610:Cntnap2 UTSW 6 45,992,191 (GRCm39) missense probably benign 0.08
R6761:Cntnap2 UTSW 6 47,026,307 (GRCm39) missense probably benign 0.03
R7125:Cntnap2 UTSW 6 46,965,580 (GRCm39) missense probably benign 0.12
R7329:Cntnap2 UTSW 6 47,248,205 (GRCm39) missense possibly damaging 0.94
R7927:Cntnap2 UTSW 6 47,072,621 (GRCm39) missense possibly damaging 0.93
R8057:Cntnap2 UTSW 6 46,324,079 (GRCm39) missense probably damaging 0.98
R8261:Cntnap2 UTSW 6 47,072,627 (GRCm39) missense probably damaging 0.98
R8356:Cntnap2 UTSW 6 47,026,307 (GRCm39) missense probably benign 0.03
R8479:Cntnap2 UTSW 6 46,736,707 (GRCm39) missense probably benign 0.14
R8503:Cntnap2 UTSW 6 45,968,975 (GRCm39) missense probably damaging 1.00
R8698:Cntnap2 UTSW 6 47,026,156 (GRCm39) missense probably damaging 1.00
R8719:Cntnap2 UTSW 6 45,978,161 (GRCm39) missense probably damaging 1.00
R8816:Cntnap2 UTSW 6 46,833,076 (GRCm39) missense possibly damaging 0.72
R8987:Cntnap2 UTSW 6 46,460,983 (GRCm39) missense probably benign 0.01
R9000:Cntnap2 UTSW 6 46,461,139 (GRCm39) intron probably benign
R9209:Cntnap2 UTSW 6 47,026,183 (GRCm39) missense probably damaging 1.00
R9253:Cntnap2 UTSW 6 45,978,112 (GRCm39) missense probably benign 0.00
R9310:Cntnap2 UTSW 6 45,978,281 (GRCm39) missense probably damaging 1.00
R9395:Cntnap2 UTSW 6 45,978,244 (GRCm39) missense probably damaging 0.98
R9462:Cntnap2 UTSW 6 46,211,217 (GRCm39) missense probably damaging 0.99
R9526:Cntnap2 UTSW 6 45,992,165 (GRCm39) missense probably damaging 1.00
R9600:Cntnap2 UTSW 6 45,969,009 (GRCm39) missense probably damaging 0.98
R9621:Cntnap2 UTSW 6 46,965,726 (GRCm39) missense probably damaging 0.98
R9738:Cntnap2 UTSW 6 45,992,373 (GRCm39) frame shift probably null
R9745:Cntnap2 UTSW 6 46,211,100 (GRCm39) missense probably benign 0.01
R9775:Cntnap2 UTSW 6 47,026,261 (GRCm39) missense probably damaging 1.00
RF022:Cntnap2 UTSW 6 46,998,599 (GRCm39) missense probably damaging 1.00
X0018:Cntnap2 UTSW 6 45,986,452 (GRCm39) missense possibly damaging 0.53
X0063:Cntnap2 UTSW 6 46,998,688 (GRCm39) missense possibly damaging 0.92
X0066:Cntnap2 UTSW 6 46,211,179 (GRCm39) missense probably benign 0.03
Z1176:Cntnap2 UTSW 6 47,248,082 (GRCm39) missense probably benign 0.00
Z1177:Cntnap2 UTSW 6 45,992,233 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GATTGCTCCCTCTAACTCGG -3'
(R):5'- TAATAAGCCACACCTGTTGGG -3'

Sequencing Primer
(F):5'- AACTCGGTTTTATTCCAGTCTAATG -3'
(R):5'- GGGTTGTTTAGGCAATTGCAAACAC -3'
Posted On 2019-10-17