Incidental Mutation 'R7502:Itpr1'
ID581548
Institutional Source Beutler Lab
Gene Symbol Itpr1
Ensembl Gene ENSMUSG00000030102
Gene Nameinositol 1,4,5-trisphosphate receptor 1
SynonymsP400, Itpr-1, IP3R1, Pcp1, Pcp-1, Ip3r, InsP3R type I, opt
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_010585.5; MGI: 96623

Is this an essential gene? Probably essential (E-score: 0.811) question?
Stock #R7502 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location108213096-108551109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108383678 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 688 (E688D)
Ref Sequence ENSEMBL: ENSMUSP00000032192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032192] [ENSMUST00000203615] [ENSMUST00000212125]
PDB Structure
Crystal structure of the inositol 1,4,5-trisphosphate receptor binding core in complex with IP3 [X-RAY DIFFRACTION]
Crystal structure of the ligand binding suppressor domain of type 1 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000032192
AA Change: E688D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032192
Gene: ENSMUSG00000030102
AA Change: E688D

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1758 1787 N/A INTRINSIC
Pfam:RIH_assoc 1959 2069 1.2e-33 PFAM
transmembrane domain 2274 2296 N/A INTRINSIC
Pfam:Ion_trans 2311 2600 9e-22 PFAM
coiled coil region 2683 2732 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203615
AA Change: E688D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144880
Gene: ENSMUSG00000030102
AA Change: E688D

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1757 1786 N/A INTRINSIC
Pfam:RIH_assoc 1958 2068 1.2e-33 PFAM
transmembrane domain 2273 2295 N/A INTRINSIC
Pfam:Ion_trans 2310 2599 9e-22 PFAM
coiled coil region 2682 2731 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212125
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype Strain: 2180360; 3715928; 1856981
Lethality: D10-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular receptor for inositol 1,4,5-trisphosphate. Upon stimulation by inositol 1,4,5-trisphosphate, this receptor mediates calcium release from the endoplasmic reticulum. Mutations in this gene cause spinocerebellar ataxia type 15, a disease associated with an heterogeneous group of cerebellar disorders. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Most homozygotes for a targeted null mutation die in utero, while survivors exhibit severe ataxia, seizures, and lethality by weaning age. Homozygotes for a spontaneous mutation exhibit a postnatal phenotype similar to that of knockout mutants. [provided by MGI curators]
Allele List at MGI

All alleles(71) : Targeted(2) Gene trapped(67) Spontaneous(2)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T C 12: 55,304,421 Y172H probably damaging Het
Acan A G 7: 79,094,203 T661A probably damaging Het
Actrt2 T C 4: 154,666,926 Y251C probably benign Het
Adat3 T A 10: 80,606,421 V31D probably damaging Het
Adgrf4 T C 17: 42,669,657 H179R possibly damaging Het
Ahcyl1 A T 3: 107,671,197 Y241* probably null Het
Anks1 C A 17: 28,008,140 T589K possibly damaging Het
Arhgap15 A G 2: 43,780,618 T5A probably benign Het
Cacna1e A T 1: 154,468,988 M1130K probably null Het
Ccdc121 G A 1: 181,510,878 Q170* probably null Het
Ccdc173 A T 2: 69,776,144 D309E probably benign Het
Ceacam18 A T 7: 43,636,874 D57V probably damaging Het
Celf1 C T 2: 91,004,755 Q194* probably null Het
Celsr2 T A 3: 108,398,902 T2029S probably benign Het
Cep170 T C 1: 176,756,029 D163G probably damaging Het
Cftr T C 6: 18,214,296 F157S probably damaging Het
Chchd3 T C 6: 32,968,229 E114G probably damaging Het
Cntnap2 T A 6: 46,484,029 S666R possibly damaging Het
Col6a5 C T 9: 105,875,876 V2266I probably benign Het
Ctr9 A G 7: 111,033,926 D127G probably benign Het
Ctsl A T 13: 64,367,068 F141I probably damaging Het
Dcpp1 T A 17: 23,882,641 Y121* probably null Het
Ddx42 T C 11: 106,247,739 V788A probably benign Het
Ehd4 T C 2: 120,091,393 I461V probably benign Het
Elp6 C A 9: 110,305,308 L5I possibly damaging Het
Faap20 T C 4: 155,250,336 S2P Het
Fam98b A C 2: 117,263,863 Y218S probably damaging Het
Fbxl4 T A 4: 22,376,655 D30E probably benign Het
Fcrlb T C 1: 170,908,641 T189A probably damaging Het
Gfpt1 A G 6: 87,066,689 D302G probably benign Het
Gzmg T G 14: 56,156,827 E203D not run Het
Hrasls T C 16: 29,228,167 V146A probably benign Het
Hsph1 A C 5: 149,630,373 V210G probably damaging Het
Il20rb A T 9: 100,468,426 M138K probably damaging Het
Jmjd1c T G 10: 67,232,015 S1585A probably damaging Het
Kcnk3 A T 5: 30,622,718 T371S possibly damaging Het
Kif11 T A 19: 37,409,807 S694T possibly damaging Het
Kpna7 T A 5: 145,005,921 H85L probably benign Het
Lipf A T 19: 33,976,606 I366F probably damaging Het
Lrrc27 A G 7: 139,214,832 H37R probably benign Het
Mfsd7a G A 5: 108,443,780 probably null Het
Mki67 T C 7: 135,700,783 T841A possibly damaging Het
Mtss1 A G 15: 58,948,361 S120P probably damaging Het
Nav1 A G 1: 135,469,666 W922R probably damaging Het
Nwd1 A G 8: 72,707,393 E1206G probably damaging Het
Obscn T C 11: 58,994,809 S7933G unknown Het
Olfr117 T A 17: 37,660,231 Y34F probably damaging Het
Olfr1263 T C 2: 90,015,011 L27S probably benign Het
Olfr267 T C 4: 58,785,648 I25V probably benign Het
Olfr409-ps1 T C 11: 74,317,184 V53A probably benign Het
Olfr71 T C 4: 43,706,316 H84R probably damaging Het
Otog A T 7: 46,298,615 I162F probably damaging Het
Paf1 G A 7: 28,395,868 V153I possibly damaging Het
Pcdhga11 T A 18: 37,756,501 D187E probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pitrm1 G T 13: 6,560,622 R424L probably damaging Het
Pla2g4e T A 2: 120,174,338 probably null Het
Prrc2a T C 17: 35,162,310 N61S unknown Het
Ror1 T A 4: 100,333,630 D61E probably benign Het
Ryr3 G A 2: 112,712,361 P3168S probably benign Het
Serinc4 T A 2: 121,453,769 I289F probably damaging Het
Sez6l A T 5: 112,475,481 L68H possibly damaging Het
Sez6l2 A G 7: 126,961,743 E460G probably benign Het
Sh3tc1 C T 5: 35,706,062 G927D probably damaging Het
Slc22a27 G C 19: 7,926,382 T130S probably damaging Het
Slc38a8 C A 8: 119,501,081 A37S possibly damaging Het
Slc40a1 T C 1: 45,918,974 N100D probably damaging Het
Snx30 T C 4: 59,894,567 F382L possibly damaging Het
Sox1 A G 8: 12,396,913 N185D possibly damaging Het
Spsb1 C T 4: 149,906,928 R61H possibly damaging Het
Sptbn2 T C 19: 4,748,082 V1945A probably benign Het
St18 T A 1: 6,827,970 N665K probably benign Het
Syne1 A G 10: 5,333,446 S1540P probably damaging Het
Syne2 G A 12: 76,094,326 V1331M probably damaging Het
Tfap2c T C 2: 172,551,719 S185P probably benign Het
Tnfsf8 T A 4: 63,851,161 D71V probably damaging Het
Tnn T C 1: 160,110,359 D1196G probably benign Het
Ttll8 A G 15: 88,933,436 probably null Het
Tubgcp3 A G 8: 12,641,207 F444L probably damaging Het
Txndc11 G A 16: 11,087,878 P596L probably benign Het
Ubr4 C T 4: 139,412,672 P1189S possibly damaging Het
Usp32 T C 11: 85,022,898 D869G possibly damaging Het
Vmn1r202 G T 13: 22,502,018 N76K probably damaging Het
Wfdc6a C T 2: 164,579,841 M132I probably benign Het
Wnk2 A T 13: 49,147,244 probably null Het
Xbp1 A G 11: 5,524,683 probably null Het
Zfp551 A T 7: 12,415,798 Y561* probably null Het
Other mutations in Itpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Itpr1 APN 6 108471120 missense probably damaging 0.98
IGL01073:Itpr1 APN 6 108413820 missense probably benign 0.00
IGL01105:Itpr1 APN 6 108381333 missense probably benign 0.00
IGL01296:Itpr1 APN 6 108399361 missense probably damaging 1.00
IGL01325:Itpr1 APN 6 108381208 missense probably benign 0.01
IGL01418:Itpr1 APN 6 108339624 critical splice donor site probably null
IGL01464:Itpr1 APN 6 108386727 missense possibly damaging 0.95
IGL01467:Itpr1 APN 6 108488496 missense probably damaging 0.96
IGL01645:Itpr1 APN 6 108473599 missense possibly damaging 0.91
IGL01672:Itpr1 APN 6 108381032 nonsense probably null
IGL01969:Itpr1 APN 6 108377691 missense probably damaging 1.00
IGL02164:Itpr1 APN 6 108389483 missense probably benign 0.08
IGL02206:Itpr1 APN 6 108549820 missense probably damaging 1.00
IGL02232:Itpr1 APN 6 108417923 missense probably damaging 1.00
IGL02297:Itpr1 APN 6 108339517 missense possibly damaging 0.84
IGL02434:Itpr1 APN 6 108489922 splice site probably null
IGL02568:Itpr1 APN 6 108339554 missense possibly damaging 0.82
IGL02992:Itpr1 APN 6 108381315 missense probably damaging 1.00
IGL03109:Itpr1 APN 6 108417981 missense probably damaging 1.00
IGL03130:Itpr1 APN 6 108523401 missense probably benign 0.00
IGL03333:Itpr1 APN 6 108380910 unclassified probably benign
aboriginal UTSW 6 108515947 missense probably benign
approximation UTSW 6 108394841 missense probably benign
estimate UTSW 6 108389553 missense probably null 1.00
icarus UTSW 6 108410900 missense probably damaging 1.00
primordial UTSW 6 108518755 missense probably benign 0.06
roo UTSW 6 108410867 missense probably benign 0.00
wallaby UTSW 6 108389387 missense probably damaging 1.00
P0005:Itpr1 UTSW 6 108381257 missense probably damaging 1.00
PIT4366001:Itpr1 UTSW 6 108493757 nonsense probably null
R0019:Itpr1 UTSW 6 108354626 missense probably damaging 1.00
R0128:Itpr1 UTSW 6 108471209 splice site probably benign
R0129:Itpr1 UTSW 6 108349676 missense probably damaging 1.00
R0135:Itpr1 UTSW 6 108488482 splice site probably benign
R0244:Itpr1 UTSW 6 108473589 missense probably benign 0.00
R0391:Itpr1 UTSW 6 108378167 missense probably benign 0.22
R0543:Itpr1 UTSW 6 108515748 splice site probably benign
R0647:Itpr1 UTSW 6 108383698 missense probably damaging 1.00
R0766:Itpr1 UTSW 6 108410900 missense probably damaging 1.00
R0971:Itpr1 UTSW 6 108349629 missense possibly damaging 0.70
R1083:Itpr1 UTSW 6 108510696 missense possibly damaging 0.92
R1277:Itpr1 UTSW 6 108339621 missense probably benign 0.22
R1403:Itpr1 UTSW 6 108389553 missense probably null 1.00
R1403:Itpr1 UTSW 6 108389553 missense probably null 1.00
R1404:Itpr1 UTSW 6 108386648 missense probably benign 0.04
R1404:Itpr1 UTSW 6 108386648 missense probably benign 0.04
R1605:Itpr1 UTSW 6 108349659 missense possibly damaging 0.77
R1661:Itpr1 UTSW 6 108482897 missense probably benign 0.38
R1852:Itpr1 UTSW 6 108386706 missense probably damaging 1.00
R1929:Itpr1 UTSW 6 108493755 missense probably damaging 1.00
R2012:Itpr1 UTSW 6 108440536 missense probably benign 0.02
R2027:Itpr1 UTSW 6 108386853 missense possibly damaging 0.80
R2111:Itpr1 UTSW 6 108378309 unclassified probably benign
R2166:Itpr1 UTSW 6 108388225 missense probably damaging 1.00
R2272:Itpr1 UTSW 6 108493755 missense probably damaging 1.00
R2484:Itpr1 UTSW 6 108369110 missense probably damaging 1.00
R3115:Itpr1 UTSW 6 108406109 missense possibly damaging 0.55
R3751:Itpr1 UTSW 6 108349680 missense probably damaging 1.00
R3798:Itpr1 UTSW 6 108381270 missense probably damaging 1.00
R3930:Itpr1 UTSW 6 108394841 missense probably benign
R4081:Itpr1 UTSW 6 108391835 missense probably damaging 1.00
R4119:Itpr1 UTSW 6 108394355 missense probably benign
R4406:Itpr1 UTSW 6 108354663 missense probably damaging 1.00
R4506:Itpr1 UTSW 6 108432686 missense probably damaging 1.00
R4616:Itpr1 UTSW 6 108481223 missense probably damaging 1.00
R4655:Itpr1 UTSW 6 108481293 missense probably damaging 1.00
R4661:Itpr1 UTSW 6 108410931 critical splice donor site probably null
R4760:Itpr1 UTSW 6 108349632 missense probably benign 0.29
R4836:Itpr1 UTSW 6 108389537 missense probably damaging 0.99
R4857:Itpr1 UTSW 6 108410867 missense probably benign 0.00
R4876:Itpr1 UTSW 6 108482906 missense probably damaging 0.97
R4939:Itpr1 UTSW 6 108440558 nonsense probably null
R5076:Itpr1 UTSW 6 108405529 splice site probably null
R5088:Itpr1 UTSW 6 108389387 missense probably damaging 1.00
R5248:Itpr1 UTSW 6 108542062 missense probably damaging 1.00
R5290:Itpr1 UTSW 6 108406145 missense possibly damaging 0.95
R5308:Itpr1 UTSW 6 108356511 missense probably damaging 1.00
R5339:Itpr1 UTSW 6 108393961 missense probably damaging 1.00
R5368:Itpr1 UTSW 6 108387498 missense probably damaging 1.00
R5369:Itpr1 UTSW 6 108519424 missense probably damaging 0.99
R5419:Itpr1 UTSW 6 108493794 missense possibly damaging 0.95
R5615:Itpr1 UTSW 6 108488600 missense possibly damaging 0.71
R5779:Itpr1 UTSW 6 108352143 missense probably damaging 1.00
R5781:Itpr1 UTSW 6 108510738 missense probably benign 0.23
R5869:Itpr1 UTSW 6 108473529 missense probably benign 0.30
R5903:Itpr1 UTSW 6 108489797 intron probably benign
R5929:Itpr1 UTSW 6 108423336 missense probably benign
R5956:Itpr1 UTSW 6 108506027 missense probably benign 0.25
R6160:Itpr1 UTSW 6 108518755 missense probably benign 0.06
R6163:Itpr1 UTSW 6 108388284 missense probably damaging 1.00
R6169:Itpr1 UTSW 6 108369116 missense probably damaging 1.00
R6237:Itpr1 UTSW 6 108378203 missense possibly damaging 0.53
R6398:Itpr1 UTSW 6 108505903 missense probably damaging 0.96
R6455:Itpr1 UTSW 6 108417972 missense probably damaging 1.00
R6522:Itpr1 UTSW 6 108388276 missense probably damaging 1.00
R6524:Itpr1 UTSW 6 108363683 missense probably damaging 1.00
R6650:Itpr1 UTSW 6 108394073 splice site probably null
R6806:Itpr1 UTSW 6 108515947 missense probably benign
R6838:Itpr1 UTSW 6 108471191 missense possibly damaging 0.87
R6841:Itpr1 UTSW 6 108388192 missense probably damaging 1.00
R6896:Itpr1 UTSW 6 108481394 missense probably damaging 1.00
R7014:Itpr1 UTSW 6 108431498 critical splice donor site probably null
R7076:Itpr1 UTSW 6 108388296 missense probably benign
R7116:Itpr1 UTSW 6 108481268 missense probably damaging 0.99
R7152:Itpr1 UTSW 6 108394407 critical splice donor site probably null
R7161:Itpr1 UTSW 6 108386640 missense probably damaging 1.00
R7166:Itpr1 UTSW 6 108378190 missense probably benign 0.06
R7241:Itpr1 UTSW 6 108517620 critical splice donor site probably null
R7301:Itpr1 UTSW 6 108542024 missense possibly damaging 0.86
R7330:Itpr1 UTSW 6 108438331 missense probably benign 0.28
R7449:Itpr1 UTSW 6 108389384 missense probably damaging 0.98
R7472:Itpr1 UTSW 6 108403396 missense probably benign 0.05
R7779:Itpr1 UTSW 6 108523348 missense possibly damaging 0.75
R7828:Itpr1 UTSW 6 108482931 missense probably damaging 1.00
R7854:Itpr1 UTSW 6 108387369 missense probably damaging 1.00
R7937:Itpr1 UTSW 6 108387369 missense probably damaging 1.00
R7998:Itpr1 UTSW 6 108417948 missense possibly damaging 0.88
R8039:Itpr1 UTSW 6 108386628 missense probably damaging 1.00
Z1176:Itpr1 UTSW 6 108499149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGATCTTTGTGGCTCTGC -3'
(R):5'- ATGCCTTAGAGTGACCAACAAG -3'

Sequencing Primer
(F):5'- TCTGCCACTGGGAGAAAGAAAGAAC -3'
(R):5'- GAAAACCATATGCTCCCACTTG -3'
Posted On2019-10-17