Incidental Mutation 'R0634:Dock6'
ID58155
Institutional Source Beutler Lab
Gene Symbol Dock6
Ensembl Gene ENSMUSG00000032198
Gene Namededicator of cytokinesis 6
Synonyms2410095B20Rik, C330023D02Rik, 4931431C02Rik
MMRRC Submission 038823-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.547) question?
Stock #R0634 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21799860-21852635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 21841527 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 330 (T330I)
Ref Sequence ENSEMBL: ENSMUSP00000034728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034728] [ENSMUST00000058777] [ENSMUST00000217336]
Predicted Effect probably damaging
Transcript: ENSMUST00000034728
AA Change: T330I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034728
Gene: ENSMUSG00000032198
AA Change: T330I

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
Pfam:DUF3398 63 155 4.7e-26 PFAM
low complexity region 419 429 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
Pfam:DOCK-C2 542 721 3.4e-46 PFAM
low complexity region 754 770 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 945 965 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
low complexity region 1123 1153 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1340 1356 N/A INTRINSIC
Pfam:DHR-2 1554 2080 6.6e-214 PFAM
low complexity region 2093 2107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058777
SMART Domains Protein: ENSMUSP00000058951
Gene: ENSMUSG00000047822

DomainStartEndE-ValueType
low complexity region 171 191 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213775
Predicted Effect probably damaging
Transcript: ENSMUST00000217336
AA Change: T330I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217515
Meta Mutation Damage Score 0.2932 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis (DOCK) family of atypical guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with small GTPases and are components of intracellular signaling networks. The encoded protein is a group C DOCK protein and plays a role in actin cytoskeletal reorganization by activating the Rho GTPases Cdc42 and Rac1. Mutations in this gene are associated with Adams-Oliver syndrome 2. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,314,491 I2958V possibly damaging Het
Adam21 C A 12: 81,560,352 W212L probably benign Het
Adcy2 A C 13: 68,727,945 H479Q possibly damaging Het
Adcy4 T C 14: 55,781,597 R168G probably benign Het
Atp13a2 T C 4: 141,006,929 probably benign Het
C1ra G A 6: 124,517,505 E304K possibly damaging Het
C87977 A G 4: 144,209,340 probably null Het
Cc2d2a A C 5: 43,681,381 probably benign Het
Cenpe T C 3: 135,246,827 L1426P probably damaging Het
Cntn1 A T 15: 92,314,563 R869* probably null Het
Creb3l2 A T 6: 37,334,348 probably benign Het
Crybg2 G A 4: 134,075,304 probably benign Het
Csmd1 A T 8: 16,226,391 F800I probably damaging Het
Ets2 G A 16: 95,716,156 E311K possibly damaging Het
Fbxo22 A T 9: 55,214,960 Q141L probably benign Het
Fer C T 17: 64,035,508 T223M probably benign Het
Gm13757 A T 2: 88,446,617 M107K probably benign Het
Gm9774 C T 3: 92,428,809 W125* probably null Het
Gtf3c1 A T 7: 125,657,477 probably benign Het
Gtf3c2 G A 5: 31,159,806 R684* probably null Het
Hs6st3 T A 14: 119,869,062 L294* probably null Het
Ighg2c T G 12: 113,287,964 E181A unknown Het
Igkv6-15 A T 6: 70,406,779 probably benign Het
Lrmp A T 6: 145,174,628 H523L probably damaging Het
Map2k6 C T 11: 110,494,343 R178* probably null Het
Meikin T A 11: 54,390,483 D126E probably benign Het
Mgst1 A T 6: 138,156,331 T37S probably damaging Het
Mrc2 G A 11: 105,347,692 V1222M probably benign Het
Myom2 C A 8: 15,119,216 probably benign Het
Negr1 A G 3: 157,016,266 K159R possibly damaging Het
Nptx1 T C 11: 119,543,301 T320A possibly damaging Het
Olfr490 T C 7: 108,286,296 I277V probably benign Het
Olfr530 A T 7: 140,373,397 V71E possibly damaging Het
Pes1 C T 11: 3,977,794 probably benign Het
Pes1 T G 11: 3,977,795 probably benign Het
Pkhd1 A T 1: 20,117,474 Y3537N probably damaging Het
Poteg G A 8: 27,473,587 G289R probably benign Het
Rassf5 T C 1: 131,244,956 R59G probably damaging Het
Reln A T 5: 22,018,869 W961R probably damaging Het
Rhot2 G A 17: 25,842,028 H168Y possibly damaging Het
Ripk3 G T 14: 55,788,391 probably benign Het
Samm50 A G 15: 84,214,171 silent Het
Sap30bp T C 11: 115,957,403 I117T probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Sipa1l2 A T 8: 125,422,624 L1632* probably null Het
Sirt7 T C 11: 120,622,129 probably benign Het
Smg8 T C 11: 87,086,108 T216A possibly damaging Het
Sox9 A G 11: 112,784,942 Y319C probably damaging Het
Sspn G A 6: 145,961,151 A27T possibly damaging Het
Suco A G 1: 161,838,804 V509A possibly damaging Het
Svep1 C T 4: 58,070,661 C2375Y possibly damaging Het
Trbv21 T A 6: 41,203,050 probably benign Het
Uimc1 C T 13: 55,060,266 E455K possibly damaging Het
Upk3b A G 5: 136,040,076 T100A possibly damaging Het
Usp47 A G 7: 112,108,655 N1303D probably damaging Het
Vav1 A T 17: 57,303,862 D476V probably benign Het
Vmn1r68 A G 7: 10,527,235 V312A probably benign Het
Wdr62 A G 7: 30,270,174 V287A probably damaging Het
Zcchc4 C T 5: 52,783,208 P40S probably benign Het
Zfp326 T A 5: 105,886,203 Y26* probably null Het
Zfp592 A G 7: 81,038,071 H915R probably damaging Het
Other mutations in Dock6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Dock6 APN 9 21846634 missense possibly damaging 0.50
IGL01025:Dock6 APN 9 21811807 missense possibly damaging 0.89
IGL01390:Dock6 APN 9 21803045 missense probably damaging 1.00
IGL02025:Dock6 APN 9 21809589 missense probably damaging 0.98
IGL02028:Dock6 APN 9 21838826 missense probably damaging 1.00
IGL02311:Dock6 APN 9 21844328 missense probably damaging 1.00
IGL02441:Dock6 APN 9 21841926 missense possibly damaging 0.77
IGL02504:Dock6 APN 9 21846655 missense probably benign 0.19
IGL02516:Dock6 APN 9 21802585 missense probably damaging 1.00
IGL02836:Dock6 APN 9 21801864 missense probably damaging 1.00
IGL02894:Dock6 APN 9 21811815 missense probably damaging 1.00
bayfront UTSW 9 21821745 missense probably benign 0.29
IGL03048:Dock6 UTSW 9 21809570 missense probably damaging 1.00
R0370:Dock6 UTSW 9 21814565 missense probably benign 0.29
R0504:Dock6 UTSW 9 21802436 missense probably damaging 1.00
R0633:Dock6 UTSW 9 21844417 missense probably benign 0.00
R0671:Dock6 UTSW 9 21804627 splice site probably benign
R0839:Dock6 UTSW 9 21817892 missense probably benign 0.01
R0948:Dock6 UTSW 9 21801533 missense probably damaging 1.00
R1022:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1024:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1073:Dock6 UTSW 9 21846518 missense probably benign
R1463:Dock6 UTSW 9 21831906 missense probably damaging 1.00
R1481:Dock6 UTSW 9 21820622 missense probably benign
R1494:Dock6 UTSW 9 21814742 missense probably benign 0.34
R1547:Dock6 UTSW 9 21814588 missense probably damaging 1.00
R1654:Dock6 UTSW 9 21804843 missense probably damaging 0.98
R1782:Dock6 UTSW 9 21811846 missense probably damaging 1.00
R1905:Dock6 UTSW 9 21829574 missense probably benign 0.37
R1908:Dock6 UTSW 9 21841629 missense probably damaging 1.00
R1916:Dock6 UTSW 9 21813091 missense probably damaging 1.00
R2132:Dock6 UTSW 9 21846518 missense probably benign
R2197:Dock6 UTSW 9 21832881 missense probably damaging 1.00
R2316:Dock6 UTSW 9 21839677 missense probably damaging 0.98
R2341:Dock6 UTSW 9 21839486 splice site probably benign
R2519:Dock6 UTSW 9 21816333 missense possibly damaging 0.54
R2924:Dock6 UTSW 9 21809630 missense probably damaging 1.00
R2939:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R2940:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3078:Dock6 UTSW 9 21845754 splice site probably benign
R3081:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3810:Dock6 UTSW 9 21801577 missense probably damaging 1.00
R4246:Dock6 UTSW 9 21839490 splice site probably null
R4604:Dock6 UTSW 9 21802540 missense probably damaging 1.00
R4833:Dock6 UTSW 9 21844280 missense probably damaging 1.00
R4849:Dock6 UTSW 9 21811772 critical splice donor site probably null
R4896:Dock6 UTSW 9 21824437 missense possibly damaging 0.48
R4926:Dock6 UTSW 9 21845791 missense probably damaging 1.00
R5183:Dock6 UTSW 9 21841603 missense probably benign 0.00
R5211:Dock6 UTSW 9 21820352 missense probably benign 0.36
R5337:Dock6 UTSW 9 21829548 missense possibly damaging 0.93
R5353:Dock6 UTSW 9 21814786 missense probably benign 0.00
R5429:Dock6 UTSW 9 21832881 missense probably damaging 0.99
R5463:Dock6 UTSW 9 21809958 intron probably null
R5476:Dock6 UTSW 9 21809589 missense probably damaging 0.98
R5511:Dock6 UTSW 9 21817407 missense possibly damaging 0.59
R5534:Dock6 UTSW 9 21803076 nonsense probably null
R5718:Dock6 UTSW 9 21824493 missense probably benign 0.11
R5823:Dock6 UTSW 9 21804828 missense probably damaging 0.99
R5831:Dock6 UTSW 9 21803036 missense probably damaging 1.00
R5887:Dock6 UTSW 9 21820394 missense probably damaging 0.96
R5930:Dock6 UTSW 9 21824416 missense probably benign 0.29
R6159:Dock6 UTSW 9 21821745 missense probably benign 0.29
R6633:Dock6 UTSW 9 21820331 missense probably benign 0.17
R6633:Dock6 UTSW 9 21821503 missense probably damaging 1.00
R6665:Dock6 UTSW 9 21839912 missense probably damaging 0.99
R6744:Dock6 UTSW 9 21831474 missense probably damaging 1.00
R6903:Dock6 UTSW 9 21809564 missense probably damaging 1.00
R6981:Dock6 UTSW 9 21845550 missense probably damaging 0.99
R7024:Dock6 UTSW 9 21820370 missense probably benign
R7030:Dock6 UTSW 9 21813079 missense probably damaging 1.00
R7045:Dock6 UTSW 9 21821811 missense probably damaging 1.00
R7139:Dock6 UTSW 9 21801276 missense probably damaging 1.00
R7356:Dock6 UTSW 9 21809899 missense probably damaging 1.00
R7400:Dock6 UTSW 9 21801807 missense possibly damaging 0.62
R7847:Dock6 UTSW 9 21801207 missense unknown
R7863:Dock6 UTSW 9 21846658 missense possibly damaging 0.85
R7930:Dock6 UTSW 9 21801207 missense unknown
R7946:Dock6 UTSW 9 21846658 missense possibly damaging 0.85
R8012:Dock6 UTSW 9 21846511 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGGCCTGAAAGTACTCAAGTTGCTC -3'
(R):5'- TGAAATTGAACCCATCTTCGGCACC -3'

Sequencing Primer
(F):5'- CAAGTTGCTCCATTGTTGAAACC -3'
(R):5'- ctccctccctcctccctc -3'
Posted On2013-07-11