Incidental Mutation 'R0634:Pes1'
ID58157
Institutional Source Beutler Lab
Gene Symbol Pes1
Ensembl Gene ENSMUSG00000020430
Gene Namepescadillo ribosomal biogenesis factor 1
Synonyms
MMRRC Submission 038823-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0634 (G1)
Quality Score215
Status Validated
Chromosome11
Chromosomal Location3963975-3980004 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 3977794 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020705] [ENSMUST00000042344] [ENSMUST00000109985]
Predicted Effect probably benign
Transcript: ENSMUST00000020705
SMART Domains Protein: ENSMUSP00000020705
Gene: ENSMUSG00000020430

DomainStartEndE-ValueType
Pfam:Pescadillo_N 6 286 5.1e-135 PFAM
BRCT 323 404 4.81e-7 SMART
coiled coil region 469 542 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042344
SMART Domains Protein: ENSMUSP00000048953
Gene: ENSMUSG00000034493

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 84 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109985
SMART Domains Protein: ENSMUSP00000105612
Gene: ENSMUSG00000020430

DomainStartEndE-ValueType
Pfam:Pescadillo_N 7 284 1.1e-130 PFAM
BRCT 327 408 4.81e-7 SMART
coiled coil region 473 546 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137544
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that contains a breast cancer associated gene 1 (BRCA1) C-terminal interaction domain. The encoded protein interacts with BOP1 and WDR12 to form the PeBoW complex, which plays a critical role in cell proliferation via pre-rRNA processing and 60S ribosomal subunit maturation. Expression of this gene may play an important role in breast cancer proliferation and tumorigenicity. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Pseudogenes of this gene are located on the long arm of chromosome 4 and the short arm of chromosome 9. [provided by RefSeq, Aug 2011]
PHENOTYPE: Targeted disuption of the mouse gene results in embryonic arrest at morula stages of development, as well as failure of nucleologenesis and disruption of ribosome biogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,314,491 I2958V possibly damaging Het
Adam21 C A 12: 81,560,352 W212L probably benign Het
Adcy2 A C 13: 68,727,945 H479Q possibly damaging Het
Adcy4 T C 14: 55,781,597 R168G probably benign Het
Atp13a2 T C 4: 141,006,929 probably benign Het
C1ra G A 6: 124,517,505 E304K possibly damaging Het
C87977 A G 4: 144,209,340 probably null Het
Cc2d2a A C 5: 43,681,381 probably benign Het
Cenpe T C 3: 135,246,827 L1426P probably damaging Het
Cntn1 A T 15: 92,314,563 R869* probably null Het
Creb3l2 A T 6: 37,334,348 probably benign Het
Crybg2 G A 4: 134,075,304 probably benign Het
Csmd1 A T 8: 16,226,391 F800I probably damaging Het
Dock6 G A 9: 21,841,527 T330I probably damaging Het
Ets2 G A 16: 95,716,156 E311K possibly damaging Het
Fbxo22 A T 9: 55,214,960 Q141L probably benign Het
Fer C T 17: 64,035,508 T223M probably benign Het
Gm13757 A T 2: 88,446,617 M107K probably benign Het
Gm9774 C T 3: 92,428,809 W125* probably null Het
Gtf3c1 A T 7: 125,657,477 probably benign Het
Gtf3c2 G A 5: 31,159,806 R684* probably null Het
Hs6st3 T A 14: 119,869,062 L294* probably null Het
Ighg2c T G 12: 113,287,964 E181A unknown Het
Igkv6-15 A T 6: 70,406,779 probably benign Het
Lrmp A T 6: 145,174,628 H523L probably damaging Het
Map2k6 C T 11: 110,494,343 R178* probably null Het
Meikin T A 11: 54,390,483 D126E probably benign Het
Mgst1 A T 6: 138,156,331 T37S probably damaging Het
Mrc2 G A 11: 105,347,692 V1222M probably benign Het
Myom2 C A 8: 15,119,216 probably benign Het
Negr1 A G 3: 157,016,266 K159R possibly damaging Het
Nptx1 T C 11: 119,543,301 T320A possibly damaging Het
Olfr490 T C 7: 108,286,296 I277V probably benign Het
Olfr530 A T 7: 140,373,397 V71E possibly damaging Het
Pkhd1 A T 1: 20,117,474 Y3537N probably damaging Het
Poteg G A 8: 27,473,587 G289R probably benign Het
Rassf5 T C 1: 131,244,956 R59G probably damaging Het
Reln A T 5: 22,018,869 W961R probably damaging Het
Rhot2 G A 17: 25,842,028 H168Y possibly damaging Het
Ripk3 G T 14: 55,788,391 probably benign Het
Samm50 A G 15: 84,214,171 silent Het
Sap30bp T C 11: 115,957,403 I117T probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Sipa1l2 A T 8: 125,422,624 L1632* probably null Het
Sirt7 T C 11: 120,622,129 probably benign Het
Smg8 T C 11: 87,086,108 T216A possibly damaging Het
Sox9 A G 11: 112,784,942 Y319C probably damaging Het
Sspn G A 6: 145,961,151 A27T possibly damaging Het
Suco A G 1: 161,838,804 V509A possibly damaging Het
Svep1 C T 4: 58,070,661 C2375Y possibly damaging Het
Trbv21 T A 6: 41,203,050 probably benign Het
Uimc1 C T 13: 55,060,266 E455K possibly damaging Het
Upk3b A G 5: 136,040,076 T100A possibly damaging Het
Usp47 A G 7: 112,108,655 N1303D probably damaging Het
Vav1 A T 17: 57,303,862 D476V probably benign Het
Vmn1r68 A G 7: 10,527,235 V312A probably benign Het
Wdr62 A G 7: 30,270,174 V287A probably damaging Het
Zcchc4 C T 5: 52,783,208 P40S probably benign Het
Zfp326 T A 5: 105,886,203 Y26* probably null Het
Zfp592 A G 7: 81,038,071 H915R probably damaging Het
Other mutations in Pes1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Pes1 APN 11 3976803 missense probably damaging 1.00
IGL01448:Pes1 APN 11 3977979 missense possibly damaging 0.89
H8441:Pes1 UTSW 11 3977636 small deletion probably benign
R0634:Pes1 UTSW 11 3977795 splice site probably benign
R0883:Pes1 UTSW 11 3975557 missense probably damaging 1.00
R0980:Pes1 UTSW 11 3977636 small deletion probably benign
R1435:Pes1 UTSW 11 3976075 missense probably benign 0.00
R1557:Pes1 UTSW 11 3976824 missense probably damaging 1.00
R1694:Pes1 UTSW 11 3977719 small deletion probably benign
R1885:Pes1 UTSW 11 3969482 missense probably damaging 1.00
R1929:Pes1 UTSW 11 3969524 missense probably damaging 1.00
R2270:Pes1 UTSW 11 3969524 missense probably damaging 1.00
R2272:Pes1 UTSW 11 3969524 missense probably damaging 1.00
R2362:Pes1 UTSW 11 3977123 missense probably damaging 1.00
R2869:Pes1 UTSW 11 3976834 missense probably benign 0.05
R2869:Pes1 UTSW 11 3976834 missense probably benign 0.05
R2870:Pes1 UTSW 11 3976834 missense probably benign 0.05
R2870:Pes1 UTSW 11 3976834 missense probably benign 0.05
R2871:Pes1 UTSW 11 3976834 missense probably benign 0.05
R2871:Pes1 UTSW 11 3976834 missense probably benign 0.05
R2873:Pes1 UTSW 11 3976834 missense probably benign 0.05
R3024:Pes1 UTSW 11 3977719 small deletion probably benign
R3039:Pes1 UTSW 11 3975547 missense probably damaging 1.00
R3195:Pes1 UTSW 11 3975736 splice site probably benign
R3773:Pes1 UTSW 11 3975548 missense probably damaging 1.00
R4590:Pes1 UTSW 11 3977986 missense probably damaging 1.00
R4739:Pes1 UTSW 11 3964058 missense probably damaging 1.00
R5396:Pes1 UTSW 11 3977719 small deletion probably benign
R6016:Pes1 UTSW 11 3978004 missense possibly damaging 0.68
R6351:Pes1 UTSW 11 3978865 missense probably benign
R6921:Pes1 UTSW 11 3973330 missense probably damaging 0.98
R7315:Pes1 UTSW 11 3976085 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCATAGGGTTGTCAGTTTTCGCAC -3'
(R):5'- CAGGAACCTACCTCTCGGATTTTGC -3'

Sequencing Primer
(F):5'- AGAAGTTACCTGCGATCTGC -3'
(R):5'- GATTTTGCGCCGCTTGC -3'
Posted On2013-07-11