Incidental Mutation 'R7502:Usp32'
ID 581571
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Name ubiquitin specific peptidase 32
Synonyms 6430526O11Rik, 2900074J03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7502 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 84984442-85140161 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 85022898 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 869 (D869G)
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
AlphaFold F8VPZ3
Predicted Effect
SMART Domains Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804
AA Change: D167G

DomainStartEndE-ValueType
Pfam:UCH 32 260 4.1e-51 PFAM
Pfam:UCH_1 33 228 1.7e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108075
AA Change: D869G

PolyPhen 2 Score 0.484 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: D869G

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174602
SMART Domains Protein: ENSMUSP00000134476
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Pfam:DUSP 1 65 6.5e-17 PFAM
Pfam:Ubiquitin_3 122 216 8e-10 PFAM
Pfam:UCH 238 257 1.2e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T C 12: 55,304,421 Y172H probably damaging Het
Acan A G 7: 79,094,203 T661A probably damaging Het
Actrt2 T C 4: 154,666,926 Y251C probably benign Het
Adat3 T A 10: 80,606,421 V31D probably damaging Het
Adgrf4 T C 17: 42,669,657 H179R possibly damaging Het
Ahcyl1 A T 3: 107,671,197 Y241* probably null Het
Anks1 C A 17: 28,008,140 T589K possibly damaging Het
Arhgap15 A G 2: 43,780,618 T5A probably benign Het
Cacna1e A T 1: 154,468,988 M1130K probably null Het
Ccdc121 G A 1: 181,510,878 Q170* probably null Het
Ccdc173 A T 2: 69,776,144 D309E probably benign Het
Ceacam18 A T 7: 43,636,874 D57V probably damaging Het
Celf1 C T 2: 91,004,755 Q194* probably null Het
Celsr2 T A 3: 108,398,902 T2029S probably benign Het
Cep170 T C 1: 176,756,029 D163G probably damaging Het
Cftr T C 6: 18,214,296 F157S probably damaging Het
Chchd3 T C 6: 32,968,229 E114G probably damaging Het
Cntnap2 T A 6: 46,484,029 S666R possibly damaging Het
Col6a5 C T 9: 105,875,876 V2266I probably benign Het
Ctr9 A G 7: 111,033,926 D127G probably benign Het
Ctsl A T 13: 64,367,068 F141I probably damaging Het
Dcpp1 T A 17: 23,882,641 Y121* probably null Het
Ddx42 T C 11: 106,247,739 V788A probably benign Het
Ehd4 T C 2: 120,091,393 I461V probably benign Het
Elp6 C A 9: 110,305,308 L5I possibly damaging Het
Faap20 T C 4: 155,250,336 S2P Het
Fam98b A C 2: 117,263,863 Y218S probably damaging Het
Fbxl4 T A 4: 22,376,655 D30E probably benign Het
Fcrlb T C 1: 170,908,641 T189A probably damaging Het
Gfpt1 A G 6: 87,066,689 D302G probably benign Het
Gzmg T G 14: 56,156,827 E203D not run Het
Hrasls T C 16: 29,228,167 V146A probably benign Het
Hsph1 A C 5: 149,630,373 V210G probably damaging Het
Il20rb A T 9: 100,468,426 M138K probably damaging Het
Itpr1 A T 6: 108,383,678 E688D probably benign Het
Jmjd1c T G 10: 67,232,015 S1585A probably damaging Het
Kcnk3 A T 5: 30,622,718 T371S possibly damaging Het
Kif11 T A 19: 37,409,807 S694T possibly damaging Het
Kpna7 T A 5: 145,005,921 H85L probably benign Het
Lipf A T 19: 33,976,606 I366F probably damaging Het
Lrrc27 A G 7: 139,214,832 H37R probably benign Het
Mfsd7a G A 5: 108,443,780 probably null Het
Mki67 T C 7: 135,700,783 T841A possibly damaging Het
Mtss1 A G 15: 58,948,361 S120P probably damaging Het
Nav1 A G 1: 135,469,666 W922R probably damaging Het
Nwd1 A G 8: 72,707,393 E1206G probably damaging Het
Obscn T C 11: 58,994,809 S7933G unknown Het
Olfr117 T A 17: 37,660,231 Y34F probably damaging Het
Olfr1263 T C 2: 90,015,011 L27S probably benign Het
Olfr267 T C 4: 58,785,648 I25V probably benign Het
Olfr409-ps1 T C 11: 74,317,184 V53A probably benign Het
Olfr71 T C 4: 43,706,316 H84R probably damaging Het
Otog A T 7: 46,298,615 I162F probably damaging Het
Paf1 G A 7: 28,395,868 V153I possibly damaging Het
Pcdhga11 T A 18: 37,756,501 D187E probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pitrm1 G T 13: 6,560,622 R424L probably damaging Het
Pla2g4e T A 2: 120,174,338 probably null Het
Prrc2a T C 17: 35,162,310 N61S unknown Het
Ror1 T A 4: 100,333,630 D61E probably benign Het
Ryr3 G A 2: 112,712,361 P3168S probably benign Het
Serinc4 T A 2: 121,453,769 I289F probably damaging Het
Sez6l A T 5: 112,475,481 L68H possibly damaging Het
Sez6l2 A G 7: 126,961,743 E460G probably benign Het
Sh3tc1 C T 5: 35,706,062 G927D probably damaging Het
Slc22a27 G C 19: 7,926,382 T130S probably damaging Het
Slc38a8 C A 8: 119,501,081 A37S possibly damaging Het
Slc40a1 T C 1: 45,918,974 N100D probably damaging Het
Snx30 T C 4: 59,894,567 F382L possibly damaging Het
Sox1 A G 8: 12,396,913 N185D possibly damaging Het
Spsb1 C T 4: 149,906,928 R61H possibly damaging Het
Sptbn2 T C 19: 4,748,082 V1945A probably benign Het
St18 T A 1: 6,827,970 N665K probably benign Het
Syne1 A G 10: 5,333,446 S1540P probably damaging Het
Syne2 G A 12: 76,094,326 V1331M probably damaging Het
Tfap2c T C 2: 172,551,719 S185P probably benign Het
Tnfsf8 T A 4: 63,851,161 D71V probably damaging Het
Tnn T C 1: 160,110,359 D1196G probably benign Het
Ttll8 A G 15: 88,933,436 probably null Het
Tubgcp3 A G 8: 12,641,207 F444L probably damaging Het
Txndc11 G A 16: 11,087,878 P596L probably benign Het
Ubr4 C T 4: 139,412,672 P1189S possibly damaging Het
Vmn1r202 G T 13: 22,502,018 N76K probably damaging Het
Wfdc6a C T 2: 164,579,841 M132I probably benign Het
Wnk2 A T 13: 49,147,244 probably null Het
Xbp1 A G 11: 5,524,683 probably null Het
Zfp551 A T 7: 12,415,798 Y561* probably null Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
BB010:Usp32 UTSW 11 85007059 missense probably damaging 1.00
BB020:Usp32 UTSW 11 85007059 missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 85010074 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3816:Usp32 UTSW 11 84994384 critical splice donor site probably null
R3870:Usp32 UTSW 11 85007055 nonsense probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4079:Usp32 UTSW 11 85039229 missense probably damaging 0.98
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4744:Usp32 UTSW 11 84994393 missense probably damaging 1.00
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5213:Usp32 UTSW 11 85022259 missense probably damaging 1.00
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5381:Usp32 UTSW 11 85059127 critical splice donor site probably benign
R5538:Usp32 UTSW 11 85017786 missense possibly damaging 0.65
R5659:Usp32 UTSW 11 85077414 missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84992451 critical splice donor site probably null
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6714:Usp32 UTSW 11 85026870 missense probably damaging 0.99
R6778:Usp32 UTSW 11 85025686 missense probably benign 0.00
R6988:Usp32 UTSW 11 85010143 missense probably benign 0.35
R6992:Usp32 UTSW 11 85032088 missense probably damaging 0.99
R7182:Usp32 UTSW 11 85040170 missense probably benign 0.34
R7186:Usp32 UTSW 11 85051234 missense probably benign 0.45
R7198:Usp32 UTSW 11 85022855 frame shift probably null
R7201:Usp32 UTSW 11 85022855 frame shift probably null
R7469:Usp32 UTSW 11 84988553 missense possibly damaging 0.94
R7513:Usp32 UTSW 11 85027112 nonsense probably null
R7629:Usp32 UTSW 11 85019855 frame shift probably null
R7703:Usp32 UTSW 11 85077327 missense probably damaging 0.99
R7741:Usp32 UTSW 11 84987281 missense probably damaging 0.99
R7765:Usp32 UTSW 11 84994408 missense probably damaging 1.00
R7933:Usp32 UTSW 11 85007059 missense probably damaging 1.00
R7973:Usp32 UTSW 11 85022808 missense probably damaging 0.99
R7989:Usp32 UTSW 11 85034300 missense
R7998:Usp32 UTSW 11 84994426 missense probably damaging 1.00
R8292:Usp32 UTSW 11 85077401 missense probably damaging 0.99
R8305:Usp32 UTSW 11 85032185 missense possibly damaging 0.83
R8548:Usp32 UTSW 11 85017827 missense possibly damaging 0.52
R8924:Usp32 UTSW 11 85025544 missense probably damaging 0.98
R9002:Usp32 UTSW 11 85053951 missense probably damaging 0.96
R9145:Usp32 UTSW 11 85022292 missense probably damaging 1.00
R9209:Usp32 UTSW 11 85040012 missense probably damaging 0.98
R9211:Usp32 UTSW 11 85022733 missense probably damaging 1.00
R9296:Usp32 UTSW 11 85017652 missense probably damaging 1.00
R9310:Usp32 UTSW 11 85051202 missense probably benign 0.29
R9417:Usp32 UTSW 11 84994543 missense probably damaging 1.00
R9514:Usp32 UTSW 11 85022734 missense probably damaging 0.99
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Z1177:Usp32 UTSW 11 84988612 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTTCAGAACTCTGTGACCTACCTG -3'
(R):5'- CTTGATAGGCCTGGGACAAC -3'

Sequencing Primer
(F):5'- GTGACCTACCTGTTATTTCTAAATGC -3'
(R):5'- AGGAGAAATAGATCAATTGTTGTACC -3'
Posted On 2019-10-17