Incidental Mutation 'R7502:Ddx42'
ID 581572
Institutional Source Beutler Lab
Gene Symbol Ddx42
Ensembl Gene ENSMUSG00000020705
Gene Name DEAD box helicase 42
Synonyms DEAD (Asp-Glu-Ala-Asp) box polypeptide 42, B430002H05Rik, 1810047H21Rik, SF3b125
MMRRC Submission 045575-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7502 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 106107752-106139965 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 106138565 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 788 (V788A)
Ref Sequence ENSEMBL: ENSMUSP00000021046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021046] [ENSMUST00000021048]
AlphaFold Q810A7
Predicted Effect probably benign
Transcript: ENSMUST00000021046
AA Change: V788A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021046
Gene: ENSMUSG00000020705
AA Change: V788A

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 35 52 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
low complexity region 108 114 N/A INTRINSIC
coiled coil region 116 143 N/A INTRINSIC
low complexity region 149 158 N/A INTRINSIC
DEXDc 272 474 7.61e-68 SMART
HELICc 512 593 1.58e-33 SMART
low complexity region 644 659 N/A INTRINSIC
low complexity region 722 737 N/A INTRINSIC
low complexity region 814 838 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021048
SMART Domains Protein: ENSMUSP00000021048
Gene: ENSMUSG00000020706

DomainStartEndE-ValueType
Pfam:FtsJ 24 200 2.8e-56 PFAM
low complexity region 203 218 N/A INTRINSIC
Pfam:DUF3381 231 398 1.3e-48 PFAM
low complexity region 456 475 N/A INTRINSIC
low complexity region 560 568 N/A INTRINSIC
Pfam:Spb1_C 597 831 1.8e-72 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Asp-Glu-Ala-Asp (DEAD) box protein family. Members of this protein family are putative RNA helicases, and are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 78,743,951 (GRCm39) T661A probably damaging Het
Actrt2 T C 4: 154,751,383 (GRCm39) Y251C probably benign Het
Adat3 T A 10: 80,442,255 (GRCm39) V31D probably damaging Het
Adgrf4 T C 17: 42,980,548 (GRCm39) H179R possibly damaging Het
Ahcyl1 A T 3: 107,578,513 (GRCm39) Y241* probably null Het
Anks1 C A 17: 28,227,114 (GRCm39) T589K possibly damaging Het
Arhgap15 A G 2: 43,670,630 (GRCm39) T5A probably benign Het
Cacna1e A T 1: 154,344,734 (GRCm39) M1130K probably null Het
Ccdc121rt1 G A 1: 181,338,443 (GRCm39) Q170* probably null Het
Ceacam18 A T 7: 43,286,298 (GRCm39) D57V probably damaging Het
Celf1 C T 2: 90,835,100 (GRCm39) Q194* probably null Het
Celsr2 T A 3: 108,306,218 (GRCm39) T2029S probably benign Het
Cep170 T C 1: 176,583,595 (GRCm39) D163G probably damaging Het
Cfap210 A T 2: 69,606,488 (GRCm39) D309E probably benign Het
Cftr T C 6: 18,214,295 (GRCm39) F157S probably damaging Het
Chchd3 T C 6: 32,945,164 (GRCm39) E114G probably damaging Het
Cntnap2 T A 6: 46,460,963 (GRCm39) S666R possibly damaging Het
Col6a5 C T 9: 105,753,075 (GRCm39) V2266I probably benign Het
Ctr9 A G 7: 110,633,133 (GRCm39) D127G probably benign Het
Ctsl A T 13: 64,514,882 (GRCm39) F141I probably damaging Het
Dcpp1 T A 17: 24,101,615 (GRCm39) Y121* probably null Het
Ehd4 T C 2: 119,921,874 (GRCm39) I461V probably benign Het
Elp6 C A 9: 110,134,376 (GRCm39) L5I possibly damaging Het
Faap20 T C 4: 155,334,793 (GRCm39) S2P Het
Fam98b A C 2: 117,094,344 (GRCm39) Y218S probably damaging Het
Fbxl4 T A 4: 22,376,655 (GRCm39) D30E probably benign Het
Fcrlb T C 1: 170,736,210 (GRCm39) T189A probably damaging Het
Gfpt1 A G 6: 87,043,671 (GRCm39) D302G probably benign Het
Gzmg T G 14: 56,394,284 (GRCm39) E203D not run Het
Hsph1 A C 5: 149,553,838 (GRCm39) V210G probably damaging Het
Il20rb A T 9: 100,350,479 (GRCm39) M138K probably damaging Het
Itpr1 A T 6: 108,360,639 (GRCm39) E688D probably benign Het
Jmjd1c T G 10: 67,067,794 (GRCm39) S1585A probably damaging Het
Kcnk3 A T 5: 30,780,062 (GRCm39) T371S possibly damaging Het
Kif11 T A 19: 37,398,255 (GRCm39) S694T possibly damaging Het
Kpna7 T A 5: 144,942,731 (GRCm39) H85L probably benign Het
Lipf A T 19: 33,954,006 (GRCm39) I366F probably damaging Het
Lrrc27 A G 7: 138,794,748 (GRCm39) H37R probably benign Het
Mki67 T C 7: 135,302,512 (GRCm39) T841A possibly damaging Het
Mtss1 A G 15: 58,820,210 (GRCm39) S120P probably damaging Het
Nav1 A G 1: 135,397,404 (GRCm39) W922R probably damaging Het
Nwd1 A G 8: 73,434,021 (GRCm39) E1206G probably damaging Het
Obscn T C 11: 58,885,635 (GRCm39) S7933G unknown Het
Or13j1 T C 4: 43,706,316 (GRCm39) H84R probably damaging Het
Or1p4-ps1 T C 11: 74,208,010 (GRCm39) V53A probably benign Het
Or2g25 T A 17: 37,971,122 (GRCm39) Y34F probably damaging Het
Or2k2 T C 4: 58,785,648 (GRCm39) I25V probably benign Het
Or4c52 T C 2: 89,845,355 (GRCm39) L27S probably benign Het
Otog A T 7: 45,948,039 (GRCm39) I162F probably damaging Het
Paf1 G A 7: 28,095,293 (GRCm39) V153I possibly damaging Het
Pcdhga11 T A 18: 37,889,554 (GRCm39) D187E probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pitrm1 G T 13: 6,610,658 (GRCm39) R424L probably damaging Het
Pla2g4e T A 2: 120,004,819 (GRCm39) probably null Het
Plaat1 T C 16: 29,046,919 (GRCm39) V146A probably benign Het
Prorp T C 12: 55,351,206 (GRCm39) Y172H probably damaging Het
Prrc2a T C 17: 35,381,286 (GRCm39) N61S unknown Het
Ror1 T A 4: 100,190,827 (GRCm39) D61E probably benign Het
Ryr3 G A 2: 112,542,706 (GRCm39) P3168S probably benign Het
Serinc4 T A 2: 121,284,250 (GRCm39) I289F probably damaging Het
Sez6l A T 5: 112,623,347 (GRCm39) L68H possibly damaging Het
Sez6l2 A G 7: 126,560,915 (GRCm39) E460G probably benign Het
Sh3tc1 C T 5: 35,863,406 (GRCm39) G927D probably damaging Het
Slc22a27 G C 19: 7,903,747 (GRCm39) T130S probably damaging Het
Slc38a8 C A 8: 120,227,820 (GRCm39) A37S possibly damaging Het
Slc40a1 T C 1: 45,958,134 (GRCm39) N100D probably damaging Het
Slc49a3 G A 5: 108,591,646 (GRCm39) probably null Het
Snx30 T C 4: 59,894,567 (GRCm39) F382L possibly damaging Het
Sox1 A G 8: 12,446,913 (GRCm39) N185D possibly damaging Het
Spsb1 C T 4: 149,991,385 (GRCm39) R61H possibly damaging Het
Sptbn2 T C 19: 4,798,110 (GRCm39) V1945A probably benign Het
St18 T A 1: 6,898,194 (GRCm39) N665K probably benign Het
Syne1 A G 10: 5,283,446 (GRCm39) S1540P probably damaging Het
Syne2 G A 12: 76,141,100 (GRCm39) V1331M probably damaging Het
Tfap2c T C 2: 172,393,639 (GRCm39) S185P probably benign Het
Tnfsf8 T A 4: 63,769,398 (GRCm39) D71V probably damaging Het
Tnn T C 1: 159,937,929 (GRCm39) D1196G probably benign Het
Ttll8 A G 15: 88,817,639 (GRCm39) probably null Het
Tubgcp3 A G 8: 12,691,207 (GRCm39) F444L probably damaging Het
Txndc11 G A 16: 10,905,742 (GRCm39) P596L probably benign Het
Ubr4 C T 4: 139,139,983 (GRCm39) P1189S possibly damaging Het
Usp32 T C 11: 84,913,724 (GRCm39) D869G possibly damaging Het
Vmn1r202 G T 13: 22,686,188 (GRCm39) N76K probably damaging Het
Wfdc6a C T 2: 164,421,761 (GRCm39) M132I probably benign Het
Wnk2 A T 13: 49,300,720 (GRCm39) probably null Het
Xbp1 A G 11: 5,474,683 (GRCm39) probably null Het
Zfp551 A T 7: 12,149,725 (GRCm39) Y561* probably null Het
Other mutations in Ddx42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Ddx42 APN 11 106,126,575 (GRCm39) missense probably damaging 0.98
IGL00833:Ddx42 APN 11 106,122,004 (GRCm39) missense possibly damaging 0.52
IGL01095:Ddx42 APN 11 106,138,325 (GRCm39) missense probably damaging 1.00
IGL01651:Ddx42 APN 11 106,138,855 (GRCm39) missense probably benign 0.00
IGL01715:Ddx42 APN 11 106,115,101 (GRCm39) missense probably damaging 1.00
IGL02097:Ddx42 APN 11 106,129,986 (GRCm39) missense probably benign 0.00
IGL03182:Ddx42 APN 11 106,138,353 (GRCm39) missense probably benign
P0045:Ddx42 UTSW 11 106,122,098 (GRCm39) missense probably damaging 1.00
R0504:Ddx42 UTSW 11 106,138,675 (GRCm39) missense probably benign 0.03
R0646:Ddx42 UTSW 11 106,123,659 (GRCm39) missense probably benign 0.00
R2277:Ddx42 UTSW 11 106,133,765 (GRCm39) missense probably damaging 1.00
R2279:Ddx42 UTSW 11 106,133,765 (GRCm39) missense probably damaging 1.00
R2297:Ddx42 UTSW 11 106,133,765 (GRCm39) missense probably damaging 1.00
R2336:Ddx42 UTSW 11 106,121,976 (GRCm39) missense possibly damaging 0.56
R2519:Ddx42 UTSW 11 106,136,155 (GRCm39) missense probably damaging 1.00
R3413:Ddx42 UTSW 11 106,138,636 (GRCm39) missense probably benign 0.00
R3498:Ddx42 UTSW 11 106,122,019 (GRCm39) missense possibly damaging 0.90
R3883:Ddx42 UTSW 11 106,138,518 (GRCm39) missense probably benign 0.03
R4421:Ddx42 UTSW 11 106,121,964 (GRCm39) missense probably damaging 1.00
R4696:Ddx42 UTSW 11 106,138,529 (GRCm39) missense probably benign 0.09
R4953:Ddx42 UTSW 11 106,133,766 (GRCm39) missense probably damaging 1.00
R5398:Ddx42 UTSW 11 106,115,724 (GRCm39) missense probably benign
R5669:Ddx42 UTSW 11 106,132,645 (GRCm39) missense probably damaging 1.00
R6091:Ddx42 UTSW 11 106,125,796 (GRCm39) missense probably damaging 1.00
R6139:Ddx42 UTSW 11 106,130,843 (GRCm39) missense probably damaging 1.00
R6643:Ddx42 UTSW 11 106,119,646 (GRCm39) missense probably benign 0.14
R6991:Ddx42 UTSW 11 106,129,970 (GRCm39) missense probably damaging 1.00
R7351:Ddx42 UTSW 11 106,138,508 (GRCm39) missense probably benign
R7792:Ddx42 UTSW 11 106,127,822 (GRCm39) missense probably damaging 1.00
R8145:Ddx42 UTSW 11 106,130,887 (GRCm39) missense possibly damaging 0.52
R8425:Ddx42 UTSW 11 106,138,550 (GRCm39) missense probably benign
R9265:Ddx42 UTSW 11 106,132,435 (GRCm39) missense probably benign 0.01
R9523:Ddx42 UTSW 11 106,132,606 (GRCm39) missense probably benign 0.40
R9681:Ddx42 UTSW 11 106,125,679 (GRCm39) missense probably damaging 1.00
RF018:Ddx42 UTSW 11 106,123,630 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GTAATCAGAAGGCCGGAACC -3'
(R):5'- CCATCAGTATGACGGCTACCAC -3'

Sequencing Primer
(F):5'- TCAGAAGGCCGGAACCTCTTC -3'
(R):5'- GGCTACCACTTTCTGGATAACGG -3'
Posted On 2019-10-17