Incidental Mutation 'R7503:Farp2'
ID581594
Institutional Source Beutler Lab
Gene Symbol Farp2
Ensembl Gene ENSMUSG00000034066
Gene NameFERM, RhoGEF and pleckstrin domain protein 2
SynonymsFir, D030026M03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7503 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location93512079-93621976 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 93567497 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Arginine at position 164 (I164R)
Ref Sequence ENSEMBL: ENSMUSP00000112725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120301] [ENSMUST00000122402]
PDB Structure
Crystal strucure of the DH domain of FARP2 [X-RAY DIFFRACTION]
Crystal strucure of the DH-PH-PH domain of FARP2 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000120301
AA Change: I164R

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000112725
Gene: ENSMUSG00000034066
AA Change: I164R

DomainStartEndE-ValueType
B41 40 234 1.48e-66 SMART
FERM_C 238 328 3.29e-35 SMART
FA 332 378 1.13e-15 SMART
low complexity region 409 421 N/A INTRINSIC
low complexity region 440 459 N/A INTRINSIC
low complexity region 462 473 N/A INTRINSIC
low complexity region 478 492 N/A INTRINSIC
RhoGEF 542 728 1.57e-56 SMART
PH 759 857 1.45e-19 SMART
low complexity region 879 890 N/A INTRINSIC
PH 931 1029 2.62e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000122402
AA Change: I164R

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113790
Gene: ENSMUSG00000034066
AA Change: I164R

DomainStartEndE-ValueType
B41 40 234 1.48e-66 SMART
FERM_C 238 328 3.29e-35 SMART
FA 332 378 1.13e-15 SMART
low complexity region 409 421 N/A INTRINSIC
low complexity region 440 459 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
low complexity region 690 700 N/A INTRINSIC
low complexity region 734 753 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (63/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit slight increase in bone volumetrics and reduced osteoclast differentiation from BMDMs cultured with M-CSF and RANKL [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T C 1: 136,215,937 D587G possibly damaging Het
A230072I06Rik G A 8: 12,279,554 G3D unknown Het
Aif1 A T 17: 35,171,573 I67N probably damaging Het
Akap11 T C 14: 78,512,001 D982G Het
Anpep A G 7: 79,826,637 L827P probably damaging Het
Arhgef5 A T 6: 43,273,999 K561N probably benign Het
Arsj T C 3: 126,364,844 F24S probably benign Het
Bard1 T C 1: 71,030,836 D661G probably damaging Het
Cc2d2b A G 19: 40,794,612 I618V unknown Het
Cfap54 T A 10: 92,887,436 probably null Het
Cfhr2 T A 1: 139,831,214 I33F probably damaging Het
Dsc1 G A 18: 20,085,865 H827Y probably damaging Het
Eif3i C T 4: 129,600,414 D31N probably damaging Het
Eno1b A T 18: 48,046,811 T19S probably damaging Het
Eva1a G A 6: 82,071,229 W29* probably null Het
Evc T C 5: 37,300,767 K803R unknown Het
F5 T A 1: 164,192,210 N751K probably damaging Het
Fam120a A T 13: 48,949,247 N177K probably benign Het
Gm20379 C T 13: 92,306,057 P26L Het
Gm4778 A T 3: 94,266,473 M259L probably benign Het
Hmgcs2 T C 3: 98,302,624 S433P probably damaging Het
Ints2 T C 11: 86,232,055 T633A probably benign Het
Invs C T 4: 48,396,347 T340M probably damaging Het
Mef2c A C 13: 83,662,504 D391A possibly damaging Het
Msh4 A C 3: 153,867,750 S756A probably damaging Het
Mylk3 T C 8: 85,353,589 T490A probably benign Het
Myo1b A T 1: 51,776,602 probably null Het
Nsmce1 A G 7: 125,471,934 S107P probably benign Het
Olfr1173 T C 2: 88,274,695 Y118C probably damaging Het
Olfr628 T A 7: 103,732,267 S114T probably damaging Het
Pcdhb21 G A 18: 37,514,975 D386N probably benign Het
Pcdhb22 T G 18: 37,519,102 L208V probably benign Het
Pigu C T 2: 155,331,144 probably null Het
Plcz1 T A 6: 139,990,748 E585V probably damaging Het
Pnpla7 C A 2: 24,983,532 C183* probably null Het
Pomgnt1 T C 4: 116,152,752 V133A possibly damaging Het
Prl3d3 A G 13: 27,161,113 Y156C probably benign Het
Prpf39 A G 12: 65,053,393 D280G probably benign Het
Recql5 C A 11: 115,895,055 A631S probably benign Het
Runx3 C A 4: 135,155,368 N138K probably damaging Het
Scaper T C 9: 55,807,754 D750G probably damaging Het
Slc16a3 T C 11: 120,957,027 L347P probably damaging Het
Slc25a1 G T 16: 17,926,439 Y209* probably null Het
Smad2 A G 18: 76,286,885 S88G probably benign Het
Sorcs1 A G 19: 50,153,052 C1125R probably benign Het
Spata21 T A 4: 141,095,303 I140N probably benign Het
Speer3 A T 5: 13,793,334 D85V probably benign Het
Stra6 A G 9: 58,151,245 N463S possibly damaging Het
Tmem14a T G 1: 21,229,399 probably null Het
Tsc1 T A 2: 28,687,076 L1130Q possibly damaging Het
Ttn T C 2: 76,781,057 D17377G possibly damaging Het
Utf1 A G 7: 139,944,133 D87G probably damaging Het
Vmn2r6 G A 3: 64,539,951 Q565* probably null Het
Vmn2r63 A T 7: 42,933,590 M67K probably benign Het
Vmn2r90 T C 17: 17,713,248 Y357H not run Het
Vmn2r97 A G 17: 18,928,208 T122A probably benign Het
Wdhd1 T C 14: 47,250,791 E753G probably benign Het
Wdr11 A G 7: 129,603,110 N213S probably benign Het
Wdr66 G T 5: 123,297,458 E994* probably null Het
Xdh A C 17: 73,926,210 D207E probably damaging Het
Zfp281 T A 1: 136,626,940 I552N possibly damaging Het
Zzef1 T A 11: 72,826,067 I361K probably damaging Het
Other mutations in Farp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Farp2 APN 1 93603381 missense probably benign 0.00
IGL00953:Farp2 APN 1 93561174 missense possibly damaging 0.92
IGL00961:Farp2 APN 1 93621313 missense possibly damaging 0.81
IGL00970:Farp2 APN 1 93560327 missense probably benign 0.00
IGL01377:Farp2 APN 1 93603459 missense possibly damaging 0.74
IGL01408:Farp2 APN 1 93618980 missense probably benign 0.19
IGL01919:Farp2 APN 1 93576433 missense probably damaging 1.00
IGL01985:Farp2 APN 1 93607602 missense probably damaging 1.00
IGL02375:Farp2 APN 1 93576463 missense probably damaging 1.00
IGL02392:Farp2 APN 1 93577650 missense probably damaging 1.00
IGL02815:Farp2 APN 1 93560285 missense probably damaging 1.00
IGL03003:Farp2 APN 1 93567418 missense probably damaging 1.00
IGL03074:Farp2 APN 1 93560327 missense probably benign 0.00
IGL03223:Farp2 APN 1 93617602 nonsense probably null
IGL03379:Farp2 APN 1 93607438 missense probably benign 0.08
IGL02802:Farp2 UTSW 1 93528610 missense probably damaging 1.00
PIT4468001:Farp2 UTSW 1 93528777 nonsense probably null
PIT4494001:Farp2 UTSW 1 93617594 missense probably damaging 1.00
R0207:Farp2 UTSW 1 93569087 missense probably damaging 0.96
R0521:Farp2 UTSW 1 93576821 critical splice acceptor site probably null
R0594:Farp2 UTSW 1 93576500 missense probably damaging 1.00
R1386:Farp2 UTSW 1 93620151 splice site probably null
R1522:Farp2 UTSW 1 93618553 missense possibly damaging 0.79
R1589:Farp2 UTSW 1 93579860 missense probably damaging 1.00
R1651:Farp2 UTSW 1 93603469 critical splice donor site probably null
R1695:Farp2 UTSW 1 93560325 missense probably damaging 0.97
R1833:Farp2 UTSW 1 93576364 splice site probably benign
R1915:Farp2 UTSW 1 93528702 missense probably benign 0.16
R2241:Farp2 UTSW 1 93579903 missense probably benign 0.31
R4505:Farp2 UTSW 1 93619010 missense probably damaging 1.00
R4518:Farp2 UTSW 1 93620641 missense probably benign 0.04
R4551:Farp2 UTSW 1 93618592 missense possibly damaging 0.92
R4723:Farp2 UTSW 1 93580899 missense probably benign 0.07
R4821:Farp2 UTSW 1 93574470 splice site probably null
R4861:Farp2 UTSW 1 93605419 missense probably damaging 1.00
R4861:Farp2 UTSW 1 93605419 missense probably damaging 1.00
R5221:Farp2 UTSW 1 93576418 missense probably damaging 0.99
R5625:Farp2 UTSW 1 93528748 missense probably damaging 1.00
R5663:Farp2 UTSW 1 93570013 missense probably damaging 1.00
R5935:Farp2 UTSW 1 93620645 critical splice donor site probably null
R6593:Farp2 UTSW 1 93569940 missense possibly damaging 0.48
R6853:Farp2 UTSW 1 93570016 missense probably damaging 1.00
R7001:Farp2 UTSW 1 93620184 missense possibly damaging 0.94
R7001:Farp2 UTSW 1 93620230 missense possibly damaging 0.94
R7133:Farp2 UTSW 1 93621234 missense probably damaging 1.00
R7134:Farp2 UTSW 1 93603459 missense probably benign 0.04
R7184:Farp2 UTSW 1 93603415 missense probably damaging 1.00
R7219:Farp2 UTSW 1 93560318 missense probably damaging 0.97
R7234:Farp2 UTSW 1 93580119 missense possibly damaging 0.94
R7426:Farp2 UTSW 1 93621228 missense possibly damaging 0.55
R7477:Farp2 UTSW 1 93581028 intron probably null
Z1176:Farp2 UTSW 1 93580136 missense probably benign
Z1176:Farp2 UTSW 1 93580461 missense probably benign
Z1176:Farp2 UTSW 1 93580467 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTGTTGCTGCTTCCCAGAG -3'
(R):5'- TGTAACTTGAGTCTATATGCAGAGC -3'

Sequencing Primer
(F):5'- GCTGCTTCCCAGAGCTTGTG -3'
(R):5'- GGCGTGTCAATTACTCAG -3'
Posted On2019-10-17