Incidental Mutation 'R7503:5730559C18Rik'
ID581595
Institutional Source Beutler Lab
Gene Symbol 5730559C18Rik
Ensembl Gene ENSMUSG00000041605
Gene NameRIKEN cDNA 5730559C18 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7503 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location136213531-136234264 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136215937 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 587 (D587G)
Ref Sequence ENSEMBL: ENSMUSP00000113785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120339] [ENSMUST00000144464] [ENSMUST00000150163] [ENSMUST00000168561] [ENSMUST00000212798]
Predicted Effect possibly damaging
Transcript: ENSMUST00000120339
AA Change: D587G

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113785
Gene: ENSMUSG00000041605
AA Change: D587G

DomainStartEndE-ValueType
low complexity region 25 65 N/A INTRINSIC
Pfam:DUF3338 101 230 6.2e-57 PFAM
low complexity region 273 316 N/A INTRINSIC
low complexity region 353 362 N/A INTRINSIC
low complexity region 466 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144464
SMART Domains Protein: ENSMUSP00000115554
Gene: ENSMUSG00000041605

DomainStartEndE-ValueType
Pfam:DUF3338 1 132 5.7e-58 PFAM
low complexity region 174 194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150163
SMART Domains Protein: ENSMUSP00000118074
Gene: ENSMUSG00000041605

DomainStartEndE-ValueType
Pfam:DUF3338 1 132 6.8e-58 PFAM
low complexity region 174 194 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168561
SMART Domains Protein: ENSMUSP00000130772
Gene: ENSMUSG00000087230

DomainStartEndE-ValueType
SCOP:d1gw5a_ 126 669 2e-7 SMART
low complexity region 677 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168561
Predicted Effect probably benign
Transcript: ENSMUST00000212798
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik G A 8: 12,279,554 G3D unknown Het
Aif1 A T 17: 35,171,573 I67N probably damaging Het
Akap11 T C 14: 78,512,001 D982G Het
Anpep A G 7: 79,826,637 L827P probably damaging Het
Arhgef5 A T 6: 43,273,999 K561N probably benign Het
Arsj T C 3: 126,364,844 F24S probably benign Het
Bard1 T C 1: 71,030,836 D661G probably damaging Het
Cc2d2b A G 19: 40,794,612 I618V unknown Het
Cfap54 T A 10: 92,887,436 probably null Het
Cfhr2 T A 1: 139,831,214 I33F probably damaging Het
Dsc1 G A 18: 20,085,865 H827Y probably damaging Het
Eif3i C T 4: 129,600,414 D31N probably damaging Het
Eno1b A T 18: 48,046,811 T19S probably damaging Het
Eva1a G A 6: 82,071,229 W29* probably null Het
Evc T C 5: 37,300,767 K803R unknown Het
F5 T A 1: 164,192,210 N751K probably damaging Het
Fam120a A T 13: 48,949,247 N177K probably benign Het
Farp2 T G 1: 93,567,497 I164R probably benign Het
Gm20379 C T 13: 92,306,057 P26L Het
Gm4778 A T 3: 94,266,473 M259L probably benign Het
Hmgcs2 T C 3: 98,302,624 S433P probably damaging Het
Ints2 T C 11: 86,232,055 T633A probably benign Het
Invs C T 4: 48,396,347 T340M probably damaging Het
Mef2c A C 13: 83,662,504 D391A possibly damaging Het
Msh4 A C 3: 153,867,750 S756A probably damaging Het
Mylk3 T C 8: 85,353,589 T490A probably benign Het
Myo1b A T 1: 51,776,602 probably null Het
Nsmce1 A G 7: 125,471,934 S107P probably benign Het
Olfr1173 T C 2: 88,274,695 Y118C probably damaging Het
Olfr628 T A 7: 103,732,267 S114T probably damaging Het
Pcdhb21 G A 18: 37,514,975 D386N probably benign Het
Pcdhb22 T G 18: 37,519,102 L208V probably benign Het
Pigu C T 2: 155,331,144 probably null Het
Plcz1 T A 6: 139,990,748 E585V probably damaging Het
Pnpla7 C A 2: 24,983,532 C183* probably null Het
Pomgnt1 T C 4: 116,152,752 V133A possibly damaging Het
Prl3d3 A G 13: 27,161,113 Y156C probably benign Het
Prpf39 A G 12: 65,053,393 D280G probably benign Het
Recql5 C A 11: 115,895,055 A631S probably benign Het
Runx3 C A 4: 135,155,368 N138K probably damaging Het
Scaper T C 9: 55,807,754 D750G probably damaging Het
Slc16a3 T C 11: 120,957,027 L347P probably damaging Het
Slc25a1 G T 16: 17,926,439 Y209* probably null Het
Smad2 A G 18: 76,286,885 S88G probably benign Het
Sorcs1 A G 19: 50,153,052 C1125R probably benign Het
Spata21 T A 4: 141,095,303 I140N probably benign Het
Speer3 A T 5: 13,793,334 D85V probably benign Het
Stra6 A G 9: 58,151,245 N463S possibly damaging Het
Tmem14a T G 1: 21,229,399 probably null Het
Tsc1 T A 2: 28,687,076 L1130Q possibly damaging Het
Ttn T C 2: 76,781,057 D17377G possibly damaging Het
Utf1 A G 7: 139,944,133 D87G probably damaging Het
Vmn2r6 G A 3: 64,539,951 Q565* probably null Het
Vmn2r63 A T 7: 42,933,590 M67K probably benign Het
Vmn2r90 T C 17: 17,713,248 Y357H not run Het
Vmn2r97 A G 17: 18,928,208 T122A probably benign Het
Wdhd1 T C 14: 47,250,791 E753G probably benign Het
Wdr11 A G 7: 129,603,110 N213S probably benign Het
Wdr66 G T 5: 123,297,458 E994* probably null Het
Xdh A C 17: 73,926,210 D207E probably damaging Het
Zfp281 T A 1: 136,626,940 I552N possibly damaging Het
Zzef1 T A 11: 72,826,067 I361K probably damaging Het
Other mutations in 5730559C18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:5730559C18Rik APN 1 136219775 missense probably damaging 1.00
IGL02466:5730559C18Rik APN 1 136216435 unclassified probably null
IGL03408:5730559C18Rik APN 1 136214405 missense probably benign
R0053:5730559C18Rik UTSW 1 136227550 missense probably benign 0.01
R0053:5730559C18Rik UTSW 1 136227550 missense probably benign 0.01
R0632:5730559C18Rik UTSW 1 136227618 missense probably benign 0.06
R1218:5730559C18Rik UTSW 1 136214402 missense probably damaging 1.00
R1611:5730559C18Rik UTSW 1 136216117 missense probably damaging 1.00
R3618:5730559C18Rik UTSW 1 136214372 missense probably benign 0.11
R4256:5730559C18Rik UTSW 1 136214350 missense probably benign 0.00
R4348:5730559C18Rik UTSW 1 136226208 missense probably damaging 1.00
R4350:5730559C18Rik UTSW 1 136226208 missense probably damaging 1.00
R4353:5730559C18Rik UTSW 1 136226208 missense probably damaging 1.00
R5343:5730559C18Rik UTSW 1 136225442 missense probably benign 0.01
R6296:5730559C18Rik UTSW 1 136221071 critical splice donor site probably null
R6597:5730559C18Rik UTSW 1 136226189 missense probably damaging 1.00
R6983:5730559C18Rik UTSW 1 136220156 missense possibly damaging 0.59
R7060:5730559C18Rik UTSW 1 136220197 missense possibly damaging 0.75
R7527:5730559C18Rik UTSW 1 136214384 missense possibly damaging 0.67
R7602:5730559C18Rik UTSW 1 136225397 nonsense probably null
R7675:5730559C18Rik UTSW 1 136216003 missense probably benign 0.04
R7756:5730559C18Rik UTSW 1 136216433 missense probably benign 0.01
R7912:5730559C18Rik UTSW 1 136227541 missense probably benign 0.03
R7993:5730559C18Rik UTSW 1 136227541 missense probably benign 0.03
X0017:5730559C18Rik UTSW 1 136220182 missense probably damaging 1.00
Z1176:5730559C18Rik UTSW 1 136219783 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- ATTACTCGGCCAGTAGTTGC -3'
(R):5'- TACCCGCTGGATACTTCCCAAC -3'

Sequencing Primer
(F):5'- ACGGGAAGCTGTACCTGTGTC -3'
(R):5'- CAACGGGGCGCTATGTGATG -3'
Posted On2019-10-17