Incidental Mutation 'R7503:F5'
ID 581598
Institutional Source Beutler Lab
Gene Symbol F5
Ensembl Gene ENSMUSG00000026579
Gene Name coagulation factor V
Synonyms Cf-5, Cf5
MMRRC Submission 045576-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7503 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 163979407-164047846 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 164019779 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 751 (N751K)
Ref Sequence ENSEMBL: ENSMUSP00000083204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086040]
AlphaFold O88783
Predicted Effect probably damaging
Transcript: ENSMUST00000086040
AA Change: N751K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083204
Gene: ENSMUSG00000026579
AA Change: N751K

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Cu-oxidase_3 67 196 4.4e-10 PFAM
low complexity region 282 300 N/A INTRINSIC
Pfam:Cu-oxidase_3 397 527 1.5e-7 PFAM
low complexity region 1013 1019 N/A INTRINSIC
low complexity region 1045 1058 N/A INTRINSIC
low complexity region 1156 1173 N/A INTRINSIC
low complexity region 1352 1366 N/A INTRINSIC
low complexity region 1368 1382 N/A INTRINSIC
low complexity region 1440 1464 N/A INTRINSIC
Pfam:Cu-oxidase_3 1600 1714 9.1e-8 PFAM
FA58C 1865 2020 8.03e-36 SMART
FA58C 2024 2180 1.96e-30 SMART
Meta Mutation Damage Score 0.1280 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: This gene encodes a glycoprotein coagulation factor that plays a critical role in the process of blood coagulation and hemostasis. The encoded protein is activated by thrombin, to generate a heterodimer containing heavy and light chains held together by calcium ions. About half of the mice lacking the encoded protein die at an embryonic stage possible due to abnormal yolk-sac vasculature while the remaining animals succumbed to massive hemorrhage immediately after birth. A point mutation in this gene has been shown to cause disseminated intravascular thrombosis in the perinatal period, resulting in frequent deaths of newborn mice. [provided by RefSeq, Apr 2015]
PHENOTYPE: Half of mice homozygous for a null allele die at E9-E10 with defects in yolk-sac vasculature and somite formation; the remaining half develop to term but die of massive hemorrhage within hours of birth. Mice homozygous for a knock-in (F5 Leiden) allele develop strain-specific perinatal thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik G A 8: 12,329,554 (GRCm39) G3D unknown Het
Aif1 A T 17: 35,390,549 (GRCm39) I67N probably damaging Het
Akap11 T C 14: 78,749,441 (GRCm39) D982G Het
Anpep A G 7: 79,476,385 (GRCm39) L827P probably damaging Het
Arhgef5 A T 6: 43,250,933 (GRCm39) K561N probably benign Het
Arsj T C 3: 126,158,493 (GRCm39) F24S probably benign Het
Bard1 T C 1: 71,069,995 (GRCm39) D661G probably damaging Het
Cc2d2b A G 19: 40,783,056 (GRCm39) I618V unknown Het
Cfap251 G T 5: 123,435,521 (GRCm39) E994* probably null Het
Cfap54 T A 10: 92,723,298 (GRCm39) probably null Het
Cfhr2 T A 1: 139,758,952 (GRCm39) I33F probably damaging Het
Dsc1 G A 18: 20,218,922 (GRCm39) H827Y probably damaging Het
Eif3i C T 4: 129,494,207 (GRCm39) D31N probably damaging Het
Eno1b A T 18: 48,179,878 (GRCm39) T19S probably damaging Het
Eva1a G A 6: 82,048,210 (GRCm39) W29* probably null Het
Evc T C 5: 37,458,111 (GRCm39) K803R unknown Het
Fam120a A T 13: 49,102,723 (GRCm39) N177K probably benign Het
Farp2 T G 1: 93,495,219 (GRCm39) I164R probably benign Het
Gm20379 C T 13: 92,442,565 (GRCm39) P26L Het
Hmgcs2 T C 3: 98,209,940 (GRCm39) S433P probably damaging Het
Inava T C 1: 136,143,675 (GRCm39) D587G possibly damaging Het
Ints2 T C 11: 86,122,881 (GRCm39) T633A probably benign Het
Invs C T 4: 48,396,347 (GRCm39) T340M probably damaging Het
Mef2c A C 13: 83,810,623 (GRCm39) D391A possibly damaging Het
Msh4 A C 3: 153,573,387 (GRCm39) S756A probably damaging Het
Mylk3 T C 8: 86,080,218 (GRCm39) T490A probably benign Het
Myo1b A T 1: 51,815,761 (GRCm39) probably null Het
Nsmce1 A G 7: 125,071,106 (GRCm39) S107P probably benign Het
Or52a24 T A 7: 103,381,474 (GRCm39) S114T probably damaging Het
Or5d43 T C 2: 88,105,039 (GRCm39) Y118C probably damaging Het
Pcdhb21 G A 18: 37,648,028 (GRCm39) D386N probably benign Het
Pcdhb22 T G 18: 37,652,155 (GRCm39) L208V probably benign Het
Pigu C T 2: 155,173,064 (GRCm39) probably null Het
Plcz1 T A 6: 139,936,474 (GRCm39) E585V probably damaging Het
Pnpla7 C A 2: 24,873,544 (GRCm39) C183* probably null Het
Pomgnt1 T C 4: 116,009,949 (GRCm39) V133A possibly damaging Het
Prl3d3 A G 13: 27,345,096 (GRCm39) Y156C probably benign Het
Prpf39 A G 12: 65,100,167 (GRCm39) D280G probably benign Het
Recql5 C A 11: 115,785,881 (GRCm39) A631S probably benign Het
Runx3 C A 4: 134,882,679 (GRCm39) N138K probably damaging Het
Scaper T C 9: 55,715,038 (GRCm39) D750G probably damaging Het
Slc16a3 T C 11: 120,847,853 (GRCm39) L347P probably damaging Het
Slc25a1 G T 16: 17,744,303 (GRCm39) Y209* probably null Het
Smad2 A G 18: 76,419,956 (GRCm39) S88G probably benign Het
Sorcs1 A G 19: 50,141,490 (GRCm39) C1125R probably benign Het
Spata21 T A 4: 140,822,614 (GRCm39) I140N probably benign Het
Speer3 A T 5: 13,843,348 (GRCm39) D85V probably benign Het
Spopfm1 A T 3: 94,173,780 (GRCm39) M259L probably benign Het
Stra6 A G 9: 58,058,528 (GRCm39) N463S possibly damaging Het
Tmem14a T G 1: 21,299,623 (GRCm39) probably null Het
Tsc1 T A 2: 28,577,088 (GRCm39) L1130Q possibly damaging Het
Ttn T C 2: 76,611,401 (GRCm39) D17377G possibly damaging Het
Utf1 A G 7: 139,524,046 (GRCm39) D87G probably damaging Het
Vmn2r6 G A 3: 64,447,372 (GRCm39) Q565* probably null Het
Vmn2r63 A T 7: 42,583,014 (GRCm39) M67K probably benign Het
Vmn2r90 T C 17: 17,933,510 (GRCm39) Y357H not run Het
Vmn2r97 A G 17: 19,148,470 (GRCm39) T122A probably benign Het
Wdhd1 T C 14: 47,488,248 (GRCm39) E753G probably benign Het
Wdr11 A G 7: 129,204,834 (GRCm39) N213S probably benign Het
Xdh A C 17: 74,233,205 (GRCm39) D207E probably damaging Het
Zfp281 T A 1: 136,554,678 (GRCm39) I552N possibly damaging Het
Zzef1 T A 11: 72,716,893 (GRCm39) I361K probably damaging Het
Other mutations in F5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:F5 APN 1 164,007,093 (GRCm39) missense probably benign 0.15
IGL00843:F5 APN 1 164,039,360 (GRCm39) missense probably benign 0.00
IGL00904:F5 APN 1 164,021,578 (GRCm39) missense probably benign
IGL00913:F5 APN 1 164,032,465 (GRCm39) missense probably damaging 1.00
IGL01099:F5 APN 1 164,021,903 (GRCm39) missense probably damaging 0.99
IGL01134:F5 APN 1 164,019,548 (GRCm39) missense possibly damaging 0.87
IGL01313:F5 APN 1 164,021,181 (GRCm39) missense probably benign 0.01
IGL01635:F5 APN 1 164,035,427 (GRCm39) missense probably benign 0.00
IGL01697:F5 APN 1 164,021,621 (GRCm39) missense probably benign 0.04
IGL01768:F5 APN 1 164,003,914 (GRCm39) missense probably benign 0.22
IGL01795:F5 APN 1 164,021,959 (GRCm39) missense probably benign 0.00
IGL01835:F5 APN 1 164,021,937 (GRCm39) missense probably benign 0.12
IGL01843:F5 APN 1 164,039,395 (GRCm39) missense probably benign 0.05
IGL01989:F5 APN 1 164,003,876 (GRCm39) missense probably benign 0.39
IGL02036:F5 APN 1 164,010,571 (GRCm39) splice site probably benign
IGL02065:F5 APN 1 164,017,695 (GRCm39) missense probably damaging 1.00
IGL02077:F5 APN 1 164,026,435 (GRCm39) missense probably damaging 1.00
IGL02139:F5 APN 1 164,020,243 (GRCm39) missense possibly damaging 0.89
IGL02210:F5 APN 1 164,017,710 (GRCm39) missense probably benign 0.00
IGL02415:F5 APN 1 164,019,498 (GRCm39) missense probably damaging 1.00
IGL02440:F5 APN 1 164,034,635 (GRCm39) missense possibly damaging 0.79
IGL02471:F5 APN 1 164,001,860 (GRCm39) missense probably damaging 1.00
IGL02535:F5 APN 1 164,026,302 (GRCm39) missense probably damaging 0.98
IGL02537:F5 APN 1 164,020,686 (GRCm39) missense probably benign 0.26
IGL02628:F5 APN 1 164,021,644 (GRCm39) missense probably damaging 0.99
IGL02638:F5 APN 1 164,012,177 (GRCm39) critical splice donor site probably null
IGL02824:F5 APN 1 164,021,916 (GRCm39) missense probably benign 0.00
IGL02977:F5 APN 1 164,021,590 (GRCm39) missense probably damaging 1.00
IGL03028:F5 APN 1 164,020,569 (GRCm39) nonsense probably null
IGL03064:F5 APN 1 164,023,163 (GRCm39) missense probably benign 0.04
IGL03127:F5 APN 1 164,021,107 (GRCm39) missense probably benign 0.45
IGL03131:F5 APN 1 163,989,388 (GRCm39) missense possibly damaging 0.62
IGL03348:F5 APN 1 164,021,721 (GRCm39) missense possibly damaging 0.49
IGL03387:F5 APN 1 164,020,801 (GRCm39) missense probably damaging 1.00
James_dean UTSW 1 164,032,389 (GRCm39) missense probably benign 0.43
BB002:F5 UTSW 1 164,003,935 (GRCm39) critical splice donor site probably null
BB012:F5 UTSW 1 164,003,935 (GRCm39) critical splice donor site probably null
R0002:F5 UTSW 1 164,029,200 (GRCm39) missense probably damaging 1.00
R0095:F5 UTSW 1 164,019,537 (GRCm39) nonsense probably null
R0116:F5 UTSW 1 164,012,483 (GRCm39) missense probably benign 0.01
R0359:F5 UTSW 1 164,007,018 (GRCm39) missense probably damaging 1.00
R0426:F5 UTSW 1 164,010,409 (GRCm39) missense probably damaging 0.99
R0452:F5 UTSW 1 164,012,676 (GRCm39) missense probably damaging 0.99
R0457:F5 UTSW 1 164,021,769 (GRCm39) missense probably benign 0.00
R0520:F5 UTSW 1 164,037,156 (GRCm39) missense probably benign 0.15
R0522:F5 UTSW 1 164,039,332 (GRCm39) missense probably damaging 1.00
R0554:F5 UTSW 1 164,007,018 (GRCm39) missense probably damaging 1.00
R0575:F5 UTSW 1 164,003,813 (GRCm39) missense probably damaging 1.00
R0734:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R0739:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1062:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1063:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1149:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1149:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1150:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1151:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1152:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1221:F5 UTSW 1 163,989,368 (GRCm39) missense probably damaging 1.00
R1284:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1286:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1358:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1360:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1362:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1383:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1465:F5 UTSW 1 164,026,402 (GRCm39) missense probably benign 0.02
R1465:F5 UTSW 1 164,026,402 (GRCm39) missense probably benign 0.02
R1545:F5 UTSW 1 164,036,529 (GRCm39) nonsense probably null
R1561:F5 UTSW 1 164,014,472 (GRCm39) nonsense probably null
R1623:F5 UTSW 1 164,023,191 (GRCm39) missense probably damaging 1.00
R1662:F5 UTSW 1 164,035,457 (GRCm39) missense probably damaging 1.00
R1673:F5 UTSW 1 164,007,089 (GRCm39) missense probably damaging 1.00
R1689:F5 UTSW 1 164,026,486 (GRCm39) missense probably damaging 1.00
R1705:F5 UTSW 1 164,045,059 (GRCm39) missense possibly damaging 0.92
R1732:F5 UTSW 1 164,001,719 (GRCm39) missense probably damaging 1.00
R1763:F5 UTSW 1 164,020,104 (GRCm39) missense probably benign 0.04
R1774:F5 UTSW 1 164,020,104 (GRCm39) missense probably benign 0.04
R1799:F5 UTSW 1 164,021,100 (GRCm39) missense possibly damaging 0.58
R1800:F5 UTSW 1 164,010,403 (GRCm39) missense probably damaging 1.00
R1842:F5 UTSW 1 164,012,129 (GRCm39) missense probably damaging 0.99
R1915:F5 UTSW 1 164,010,486 (GRCm39) missense probably damaging 0.97
R1926:F5 UTSW 1 164,007,077 (GRCm39) missense probably damaging 1.00
R2025:F5 UTSW 1 164,037,044 (GRCm39) missense probably benign 0.05
R2198:F5 UTSW 1 164,034,603 (GRCm39) missense probably damaging 1.00
R2258:F5 UTSW 1 164,019,750 (GRCm39) missense probably damaging 1.00
R2264:F5 UTSW 1 164,021,971 (GRCm39) missense probably benign 0.32
R2281:F5 UTSW 1 164,023,289 (GRCm39) missense possibly damaging 0.80
R2407:F5 UTSW 1 164,039,441 (GRCm39) missense probably damaging 1.00
R2445:F5 UTSW 1 164,017,795 (GRCm39) missense probably damaging 1.00
R2860:F5 UTSW 1 164,012,533 (GRCm39) missense probably damaging 1.00
R2861:F5 UTSW 1 164,012,533 (GRCm39) missense probably damaging 1.00
R2862:F5 UTSW 1 164,012,533 (GRCm39) missense probably damaging 1.00
R2899:F5 UTSW 1 164,014,469 (GRCm39) missense possibly damaging 0.88
R2910:F5 UTSW 1 164,032,389 (GRCm39) missense probably benign 0.43
R2912:F5 UTSW 1 164,021,488 (GRCm39) missense probably damaging 0.98
R2996:F5 UTSW 1 164,010,486 (GRCm39) missense probably damaging 0.97
R3745:F5 UTSW 1 164,014,348 (GRCm39) missense possibly damaging 0.79
R3901:F5 UTSW 1 164,003,798 (GRCm39) missense probably benign 0.08
R3902:F5 UTSW 1 164,003,798 (GRCm39) missense probably benign 0.08
R4365:F5 UTSW 1 164,012,519 (GRCm39) missense probably damaging 0.98
R4448:F5 UTSW 1 164,026,468 (GRCm39) missense possibly damaging 0.52
R4490:F5 UTSW 1 164,044,964 (GRCm39) missense probably benign 0.40
R4514:F5 UTSW 1 163,979,566 (GRCm39) unclassified probably benign
R4598:F5 UTSW 1 164,032,366 (GRCm39) missense probably benign 0.05
R4608:F5 UTSW 1 164,036,598 (GRCm39) missense probably benign 0.12
R4661:F5 UTSW 1 164,012,489 (GRCm39) missense probably damaging 1.00
R4667:F5 UTSW 1 164,001,755 (GRCm39) missense probably benign 0.00
R4689:F5 UTSW 1 163,979,542 (GRCm39) unclassified probably benign
R4716:F5 UTSW 1 164,021,488 (GRCm39) missense probably damaging 0.98
R4732:F5 UTSW 1 164,009,226 (GRCm39) missense probably damaging 1.00
R4733:F5 UTSW 1 164,009,226 (GRCm39) missense probably damaging 1.00
R4854:F5 UTSW 1 164,019,715 (GRCm39) missense probably damaging 1.00
R4908:F5 UTSW 1 164,039,389 (GRCm39) missense probably damaging 1.00
R4971:F5 UTSW 1 164,021,755 (GRCm39) missense probably benign
R5001:F5 UTSW 1 164,023,139 (GRCm39) missense probably benign 0.00
R5042:F5 UTSW 1 164,047,020 (GRCm39) missense probably damaging 1.00
R5056:F5 UTSW 1 164,019,601 (GRCm39) missense possibly damaging 0.60
R5061:F5 UTSW 1 164,021,749 (GRCm39) missense probably benign 0.00
R5143:F5 UTSW 1 164,039,397 (GRCm39) missense probably damaging 0.98
R5622:F5 UTSW 1 164,020,134 (GRCm39) missense probably benign 0.09
R5626:F5 UTSW 1 164,036,604 (GRCm39) missense probably damaging 0.98
R5658:F5 UTSW 1 164,019,907 (GRCm39) missense probably damaging 0.96
R5702:F5 UTSW 1 164,022,116 (GRCm39) nonsense probably null
R5795:F5 UTSW 1 163,979,578 (GRCm39) missense probably benign 0.09
R5884:F5 UTSW 1 164,023,215 (GRCm39) missense probably benign 0.01
R6036:F5 UTSW 1 164,012,565 (GRCm39) missense probably damaging 0.99
R6036:F5 UTSW 1 164,012,565 (GRCm39) missense probably damaging 0.99
R6151:F5 UTSW 1 164,009,204 (GRCm39) missense probably damaging 1.00
R6151:F5 UTSW 1 164,017,756 (GRCm39) missense probably damaging 1.00
R6345:F5 UTSW 1 164,019,520 (GRCm39) missense probably benign 0.13
R6391:F5 UTSW 1 164,021,062 (GRCm39) missense probably damaging 0.99
R6542:F5 UTSW 1 164,022,037 (GRCm39) missense probably benign 0.32
R6620:F5 UTSW 1 164,014,375 (GRCm39) missense probably damaging 1.00
R6750:F5 UTSW 1 164,021,076 (GRCm39) missense possibly damaging 0.58
R6754:F5 UTSW 1 164,021,332 (GRCm39) missense probably damaging 1.00
R6774:F5 UTSW 1 164,014,447 (GRCm39) missense probably damaging 1.00
R6802:F5 UTSW 1 164,006,925 (GRCm39) missense probably damaging 0.98
R6810:F5 UTSW 1 164,014,471 (GRCm39) missense probably damaging 1.00
R6983:F5 UTSW 1 164,021,698 (GRCm39) missense probably damaging 1.00
R7000:F5 UTSW 1 164,007,075 (GRCm39) missense probably damaging 1.00
R7151:F5 UTSW 1 164,029,230 (GRCm39) missense probably damaging 1.00
R7193:F5 UTSW 1 164,046,966 (GRCm39) missense probably damaging 1.00
R7230:F5 UTSW 1 164,012,522 (GRCm39) missense probably benign
R7324:F5 UTSW 1 164,021,150 (GRCm39) small deletion probably benign
R7350:F5 UTSW 1 164,020,277 (GRCm39) missense probably benign 0.08
R7466:F5 UTSW 1 164,020,897 (GRCm39) missense possibly damaging 0.61
R7626:F5 UTSW 1 164,014,481 (GRCm39) missense possibly damaging 0.95
R7742:F5 UTSW 1 164,035,453 (GRCm39) missense possibly damaging 0.51
R7837:F5 UTSW 1 164,014,363 (GRCm39) missense probably damaging 1.00
R7848:F5 UTSW 1 163,989,446 (GRCm39) missense possibly damaging 0.94
R7925:F5 UTSW 1 164,003,935 (GRCm39) critical splice donor site probably null
R8053:F5 UTSW 1 164,020,338 (GRCm39) missense probably benign 0.26
R8094:F5 UTSW 1 164,036,509 (GRCm39) missense probably benign 0.06
R8175:F5 UTSW 1 164,019,834 (GRCm39) nonsense probably null
R8209:F5 UTSW 1 164,021,959 (GRCm39) missense probably benign 0.00
R8226:F5 UTSW 1 164,021,959 (GRCm39) missense probably benign 0.00
R8266:F5 UTSW 1 164,012,693 (GRCm39) critical splice donor site probably null
R8517:F5 UTSW 1 164,003,822 (GRCm39) missense probably damaging 0.99
R8684:F5 UTSW 1 164,045,111 (GRCm39) missense probably benign 0.01
R8941:F5 UTSW 1 164,026,440 (GRCm39) missense probably benign 0.19
R9130:F5 UTSW 1 164,001,830 (GRCm39) missense probably benign 0.37
R9181:F5 UTSW 1 164,019,895 (GRCm39) missense probably benign 0.00
R9186:F5 UTSW 1 164,021,470 (GRCm39) missense probably benign
R9233:F5 UTSW 1 164,047,020 (GRCm39) missense probably damaging 1.00
R9314:F5 UTSW 1 164,029,146 (GRCm39) missense probably benign 0.01
R9631:F5 UTSW 1 164,014,423 (GRCm39) missense probably damaging 1.00
R9655:F5 UTSW 1 164,021,730 (GRCm39) missense probably benign 0.15
X0024:F5 UTSW 1 164,020,557 (GRCm39) missense probably damaging 1.00
Z1088:F5 UTSW 1 163,981,954 (GRCm39) missense probably benign 0.04
Z1176:F5 UTSW 1 164,012,085 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCGGGATTATGACAATGAGGACTC -3'
(R):5'- CGAAGTTCTCATCTAAGCCAATGAG -3'

Sequencing Primer
(F):5'- CATATGAGATTTATGAACCTCCTGC -3'
(R):5'- CTCATCTAAGCCAATGAGGTTTC -3'
Posted On 2019-10-17