Incidental Mutation 'R7503:Olfr1173'
ID581602
Institutional Source Beutler Lab
Gene Symbol Olfr1173
Ensembl Gene ENSMUSG00000075132
Gene Nameolfactory receptor 1173
SynonymsGA_x6K02T2Q125-49759783-49758845, MOR174-20_p
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R7503 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location88273040-88279875 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88274695 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 118 (Y118C)
Ref Sequence ENSEMBL: ENSMUSP00000097418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099830] [ENSMUST00000216887]
Predicted Effect probably damaging
Transcript: ENSMUST00000099830
AA Change: Y118C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097418
Gene: ENSMUSG00000075132
AA Change: Y118C

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.6e-46 PFAM
Pfam:7tm_1 39 288 1.3e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216887
AA Change: Y118C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T C 1: 136,215,937 D587G possibly damaging Het
A230072I06Rik G A 8: 12,279,554 G3D unknown Het
Aif1 A T 17: 35,171,573 I67N probably damaging Het
Akap11 T C 14: 78,512,001 D982G Het
Anpep A G 7: 79,826,637 L827P probably damaging Het
Arhgef5 A T 6: 43,273,999 K561N probably benign Het
Arsj T C 3: 126,364,844 F24S probably benign Het
Bard1 T C 1: 71,030,836 D661G probably damaging Het
Cc2d2b A G 19: 40,794,612 I618V unknown Het
Cfap54 T A 10: 92,887,436 probably null Het
Cfhr2 T A 1: 139,831,214 I33F probably damaging Het
Dsc1 G A 18: 20,085,865 H827Y probably damaging Het
Eif3i C T 4: 129,600,414 D31N probably damaging Het
Eno1b A T 18: 48,046,811 T19S probably damaging Het
Eva1a G A 6: 82,071,229 W29* probably null Het
Evc T C 5: 37,300,767 K803R unknown Het
F5 T A 1: 164,192,210 N751K probably damaging Het
Fam120a A T 13: 48,949,247 N177K probably benign Het
Farp2 T G 1: 93,567,497 I164R probably benign Het
Gm20379 C T 13: 92,306,057 P26L Het
Gm4778 A T 3: 94,266,473 M259L probably benign Het
Hmgcs2 T C 3: 98,302,624 S433P probably damaging Het
Ints2 T C 11: 86,232,055 T633A probably benign Het
Invs C T 4: 48,396,347 T340M probably damaging Het
Mef2c A C 13: 83,662,504 D391A possibly damaging Het
Msh4 A C 3: 153,867,750 S756A probably damaging Het
Mylk3 T C 8: 85,353,589 T490A probably benign Het
Myo1b A T 1: 51,776,602 probably null Het
Nsmce1 A G 7: 125,471,934 S107P probably benign Het
Olfr628 T A 7: 103,732,267 S114T probably damaging Het
Pcdhb21 G A 18: 37,514,975 D386N probably benign Het
Pcdhb22 T G 18: 37,519,102 L208V probably benign Het
Pigu C T 2: 155,331,144 probably null Het
Plcz1 T A 6: 139,990,748 E585V probably damaging Het
Pnpla7 C A 2: 24,983,532 C183* probably null Het
Pomgnt1 T C 4: 116,152,752 V133A possibly damaging Het
Prl3d3 A G 13: 27,161,113 Y156C probably benign Het
Prpf39 A G 12: 65,053,393 D280G probably benign Het
Recql5 C A 11: 115,895,055 A631S probably benign Het
Runx3 C A 4: 135,155,368 N138K probably damaging Het
Scaper T C 9: 55,807,754 D750G probably damaging Het
Slc16a3 T C 11: 120,957,027 L347P probably damaging Het
Slc25a1 G T 16: 17,926,439 Y209* probably null Het
Smad2 A G 18: 76,286,885 S88G probably benign Het
Sorcs1 A G 19: 50,153,052 C1125R probably benign Het
Spata21 T A 4: 141,095,303 I140N probably benign Het
Speer3 A T 5: 13,793,334 D85V probably benign Het
Stra6 A G 9: 58,151,245 N463S possibly damaging Het
Tmem14a T G 1: 21,229,399 probably null Het
Tsc1 T A 2: 28,687,076 L1130Q possibly damaging Het
Ttn T C 2: 76,781,057 D17377G possibly damaging Het
Utf1 A G 7: 139,944,133 D87G probably damaging Het
Vmn2r6 G A 3: 64,539,951 Q565* probably null Het
Vmn2r63 A T 7: 42,933,590 M67K probably benign Het
Vmn2r90 T C 17: 17,713,248 Y357H not run Het
Vmn2r97 A G 17: 18,928,208 T122A probably benign Het
Wdhd1 T C 14: 47,250,791 E753G probably benign Het
Wdr11 A G 7: 129,603,110 N213S probably benign Het
Wdr66 G T 5: 123,297,458 E994* probably null Het
Xdh A C 17: 73,926,210 D207E probably damaging Het
Zfp281 T A 1: 136,626,940 I552N possibly damaging Het
Zzef1 T A 11: 72,826,067 I361K probably damaging Het
Other mutations in Olfr1173
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01079:Olfr1173 APN 2 88274716 missense probably damaging 1.00
IGL01751:Olfr1173 APN 2 88274633 missense possibly damaging 0.60
IGL02009:Olfr1173 APN 2 88274712 missense probably benign 0.06
IGL02148:Olfr1173 APN 2 88274222 missense possibly damaging 0.94
IGL02833:Olfr1173 APN 2 88274432 missense probably benign
IGL03001:Olfr1173 APN 2 88274845 missense probably damaging 1.00
R0471:Olfr1173 UTSW 2 88274215 missense possibly damaging 0.95
R2136:Olfr1173 UTSW 2 88274240 missense probably damaging 0.98
R2141:Olfr1173 UTSW 2 88275010 missense probably benign 0.30
R3957:Olfr1173 UTSW 2 88275004 missense probably damaging 1.00
R4801:Olfr1173 UTSW 2 88274879 missense probably damaging 1.00
R4802:Olfr1173 UTSW 2 88274879 missense probably damaging 1.00
R5266:Olfr1173 UTSW 2 88274221 missense possibly damaging 0.49
R5371:Olfr1173 UTSW 2 88274632 missense probably damaging 1.00
R5775:Olfr1173 UTSW 2 88274701 missense probably damaging 0.98
R7222:Olfr1173 UTSW 2 88274465 missense probably benign 0.00
R7493:Olfr1173 UTSW 2 88275101 start gained probably benign
R7586:Olfr1173 UTSW 2 88274450 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGATCAATGATGCCAGGTTCAC -3'
(R):5'- TCACTCTGGTAGGAAATGTAGGC -3'

Sequencing Primer
(F):5'- TGATGCCAGGTTCACAATAAGAC -3'
(R):5'- TGGTCAGAAGGATCAACCCTAAGC -3'
Posted On2019-10-17