Incidental Mutation 'R7503:Msh4'
ID581607
Institutional Source Beutler Lab
Gene Symbol Msh4
Ensembl Gene ENSMUSG00000005493
Gene NamemutS homolog 4
SynonymsmMsh4, 4930485C04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.433) question?
Stock #R7503 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location153857149-153906138 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 153867750 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 756 (S756A)
Ref Sequence ENSEMBL: ENSMUSP00000005630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005630] [ENSMUST00000188338] [ENSMUST00000190449]
Predicted Effect probably damaging
Transcript: ENSMUST00000005630
AA Change: S756A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005630
Gene: ENSMUSG00000005493
AA Change: S756A

DomainStartEndE-ValueType
low complexity region 91 107 N/A INTRINSIC
Pfam:MutS_II 177 321 2.3e-20 PFAM
MUTSd 352 679 3.77e-37 SMART
MUTSac 695 888 1.6e-81 SMART
Blast:MUTSac 912 956 1e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000188338
AA Change: S668A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140190
Gene: ENSMUSG00000005493
AA Change: S668A

DomainStartEndE-ValueType
Pfam:MutS_II 89 233 5.3e-19 PFAM
MUTSd 264 591 9.4e-40 SMART
MUTSac 607 800 4.2e-84 SMART
Blast:MUTSac 808 866 4e-17 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000190449
AA Change: S562A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140265
Gene: ENSMUSG00000005493
AA Change: S562A

DomainStartEndE-ValueType
Pfam:MutS_II 1 127 3.3e-15 PFAM
MUTSd 158 485 9.4e-40 SMART
MUTSac 501 694 4.2e-84 SMART
Blast:MUTSac 702 760 5e-17 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA mismatch repair mutS family. This member is a meiosis-specific protein that is not involved in DNA mismatch correction, but is required for reciprocal recombination and proper segregation of homologous chromosomes at meiosis I. This protein and MSH5 form a heterodimer which binds uniquely to a Holliday Junction and its developmental progenitor, thus provoking ADP-ATP exchange, and stabilizing the interaction between parental chromosomes during meiosis double-stranded break repair. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male and female sterility associated with failure to undergo pairing during meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T C 1: 136,215,937 D587G possibly damaging Het
A230072I06Rik G A 8: 12,279,554 G3D unknown Het
Aif1 A T 17: 35,171,573 I67N probably damaging Het
Akap11 T C 14: 78,512,001 D982G Het
Anpep A G 7: 79,826,637 L827P probably damaging Het
Arhgef5 A T 6: 43,273,999 K561N probably benign Het
Arsj T C 3: 126,364,844 F24S probably benign Het
Bard1 T C 1: 71,030,836 D661G probably damaging Het
Cc2d2b A G 19: 40,794,612 I618V unknown Het
Cfap54 T A 10: 92,887,436 probably null Het
Cfhr2 T A 1: 139,831,214 I33F probably damaging Het
Dsc1 G A 18: 20,085,865 H827Y probably damaging Het
Eif3i C T 4: 129,600,414 D31N probably damaging Het
Eno1b A T 18: 48,046,811 T19S probably damaging Het
Eva1a G A 6: 82,071,229 W29* probably null Het
Evc T C 5: 37,300,767 K803R unknown Het
F5 T A 1: 164,192,210 N751K probably damaging Het
Fam120a A T 13: 48,949,247 N177K probably benign Het
Farp2 T G 1: 93,567,497 I164R probably benign Het
Gm20379 C T 13: 92,306,057 P26L Het
Gm4778 A T 3: 94,266,473 M259L probably benign Het
Hmgcs2 T C 3: 98,302,624 S433P probably damaging Het
Ints2 T C 11: 86,232,055 T633A probably benign Het
Invs C T 4: 48,396,347 T340M probably damaging Het
Mef2c A C 13: 83,662,504 D391A possibly damaging Het
Mylk3 T C 8: 85,353,589 T490A probably benign Het
Myo1b A T 1: 51,776,602 probably null Het
Nsmce1 A G 7: 125,471,934 S107P probably benign Het
Olfr1173 T C 2: 88,274,695 Y118C probably damaging Het
Olfr628 T A 7: 103,732,267 S114T probably damaging Het
Pcdhb21 G A 18: 37,514,975 D386N probably benign Het
Pcdhb22 T G 18: 37,519,102 L208V probably benign Het
Pigu C T 2: 155,331,144 probably null Het
Plcz1 T A 6: 139,990,748 E585V probably damaging Het
Pnpla7 C A 2: 24,983,532 C183* probably null Het
Pomgnt1 T C 4: 116,152,752 V133A possibly damaging Het
Prl3d3 A G 13: 27,161,113 Y156C probably benign Het
Prpf39 A G 12: 65,053,393 D280G probably benign Het
Recql5 C A 11: 115,895,055 A631S probably benign Het
Runx3 C A 4: 135,155,368 N138K probably damaging Het
Scaper T C 9: 55,807,754 D750G probably damaging Het
Slc16a3 T C 11: 120,957,027 L347P probably damaging Het
Slc25a1 G T 16: 17,926,439 Y209* probably null Het
Smad2 A G 18: 76,286,885 S88G probably benign Het
Sorcs1 A G 19: 50,153,052 C1125R probably benign Het
Spata21 T A 4: 141,095,303 I140N probably benign Het
Speer3 A T 5: 13,793,334 D85V probably benign Het
Stra6 A G 9: 58,151,245 N463S possibly damaging Het
Tmem14a T G 1: 21,229,399 probably null Het
Tsc1 T A 2: 28,687,076 L1130Q possibly damaging Het
Ttn T C 2: 76,781,057 D17377G possibly damaging Het
Utf1 A G 7: 139,944,133 D87G probably damaging Het
Vmn2r6 G A 3: 64,539,951 Q565* probably null Het
Vmn2r63 A T 7: 42,933,590 M67K probably benign Het
Vmn2r90 T C 17: 17,713,248 Y357H not run Het
Vmn2r97 A G 17: 18,928,208 T122A probably benign Het
Wdhd1 T C 14: 47,250,791 E753G probably benign Het
Wdr11 A G 7: 129,603,110 N213S probably benign Het
Wdr66 G T 5: 123,297,458 E994* probably null Het
Xdh A C 17: 73,926,210 D207E probably damaging Het
Zfp281 T A 1: 136,626,940 I552N possibly damaging Het
Zzef1 T A 11: 72,826,067 I361K probably damaging Het
Other mutations in Msh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00862:Msh4 APN 3 153883735 missense possibly damaging 0.88
IGL01098:Msh4 APN 3 153877982 splice site probably benign
IGL01609:Msh4 APN 3 153897397 missense probably damaging 1.00
IGL01785:Msh4 APN 3 153857507 missense probably damaging 1.00
IGL01939:Msh4 APN 3 153857589 missense probably damaging 1.00
IGL02022:Msh4 APN 3 153886956 missense probably damaging 1.00
IGL02209:Msh4 APN 3 153888862 missense probably damaging 1.00
IGL02224:Msh4 APN 3 153890185 missense possibly damaging 0.94
IGL02240:Msh4 APN 3 153873674 missense probably damaging 0.98
IGL02493:Msh4 APN 3 153877908 critical splice donor site probably null
IGL02576:Msh4 APN 3 153867746 missense probably damaging 1.00
IGL02616:Msh4 APN 3 153857523 missense probably benign
IGL02812:Msh4 APN 3 153901400 splice site probably benign
IGL02888:Msh4 APN 3 153896913 nonsense probably null
IGL02992:Msh4 APN 3 153872325 missense possibly damaging 0.79
IGL03191:Msh4 APN 3 153869608 missense probably damaging 0.97
P0021:Msh4 UTSW 3 153888818 missense probably damaging 1.00
R0057:Msh4 UTSW 3 153869681 missense probably benign 0.16
R0057:Msh4 UTSW 3 153869681 missense probably benign 0.16
R0368:Msh4 UTSW 3 153888825 missense probably damaging 1.00
R0377:Msh4 UTSW 3 153896890 missense probably benign 0.00
R0631:Msh4 UTSW 3 153866420 missense probably benign 0.02
R0632:Msh4 UTSW 3 153896895 missense probably damaging 1.00
R0677:Msh4 UTSW 3 153879367 missense possibly damaging 0.69
R0909:Msh4 UTSW 3 153863504 missense probably benign 0.00
R1081:Msh4 UTSW 3 153872358 missense probably benign 0.06
R1463:Msh4 UTSW 3 153857570 missense probably damaging 1.00
R1476:Msh4 UTSW 3 153863384 missense probably damaging 1.00
R1669:Msh4 UTSW 3 153876720 missense possibly damaging 0.47
R1733:Msh4 UTSW 3 153867767 missense probably damaging 1.00
R1859:Msh4 UTSW 3 153905880 missense probably benign
R2168:Msh4 UTSW 3 153867835 nonsense probably null
R2378:Msh4 UTSW 3 153863477 missense probably damaging 0.99
R2991:Msh4 UTSW 3 153905860 missense probably benign
R3025:Msh4 UTSW 3 153863491 missense probably damaging 1.00
R4604:Msh4 UTSW 3 153872283 missense probably damaging 1.00
R4757:Msh4 UTSW 3 153879387 missense probably damaging 0.99
R5205:Msh4 UTSW 3 153866412 missense probably damaging 1.00
R5285:Msh4 UTSW 3 153873713 missense probably benign 0.03
R5766:Msh4 UTSW 3 153867840 missense probably damaging 1.00
R5777:Msh4 UTSW 3 153863439 missense probably benign 0.01
R5888:Msh4 UTSW 3 153867723 critical splice donor site probably null
R7384:Msh4 UTSW 3 153888748 missense probably benign 0.23
R7408:Msh4 UTSW 3 153876745 missense probably benign 0.06
R7487:Msh4 UTSW 3 153863510 missense probably damaging 1.00
R7726:Msh4 UTSW 3 153866320 critical splice donor site probably null
R8097:Msh4 UTSW 3 153877908 critical splice donor site probably null
Z1177:Msh4 UTSW 3 153879368 missense probably benign 0.00
Z1177:Msh4 UTSW 3 153901443 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACAAGCCTGTCTGATATCCTATAC -3'
(R):5'- GCATTCTGTGTGAGAAGCGC -3'

Sequencing Primer
(F):5'- CAGCTGCCTAGAGCTGTGTATTC -3'
(R):5'- CTGTGTGAGAAGCGCAGTGC -3'
Posted On2019-10-17