Incidental Mutation 'R7503:Invs'
ID 581608
Institutional Source Beutler Lab
Gene Symbol Invs
Ensembl Gene ENSMUSG00000028344
Gene Name inversin
Synonyms
MMRRC Submission 045576-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.658) question?
Stock # R7503 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 48279760-48431954 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 48396347 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 340 (T340M)
Ref Sequence ENSEMBL: ENSMUSP00000030029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030029] [ENSMUST00000143433]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000030029
AA Change: T340M

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030029
Gene: ENSMUSG00000028344
AA Change: T340M

DomainStartEndE-ValueType
ANK 47 76 2.66e-5 SMART
ANK 80 110 1.8e-2 SMART
ANK 113 144 1.63e0 SMART
ANK 148 177 6.46e-4 SMART
ANK 181 215 3.44e1 SMART
ANK 220 250 1.11e-2 SMART
ANK 254 285 2.07e-2 SMART
ANK 288 317 3.18e-3 SMART
ANK 321 350 3.91e-3 SMART
ANK 356 385 2.28e-4 SMART
ANK 389 418 8.39e-3 SMART
ANK 422 451 3.76e-5 SMART
ANK 455 484 2.45e-4 SMART
ANK 488 517 1.31e-4 SMART
ANK 523 553 6.71e-2 SMART
IQ 554 576 5.75e-2 SMART
low complexity region 589 607 N/A INTRINSIC
IQ 913 935 2.46e-1 SMART
low complexity region 973 989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143433
AA Change: T284M

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138580
Gene: ENSMUSG00000028344
AA Change: T284M

DomainStartEndE-ValueType
ANK 47 76 2.66e-5 SMART
ANK 80 110 1.8e-2 SMART
ANK 113 144 1.63e0 SMART
ANK 164 194 1.11e-2 SMART
ANK 198 229 2.07e-2 SMART
ANK 232 261 3.18e-3 SMART
ANK 265 294 3.91e-3 SMART
ANK 300 329 2.28e-4 SMART
ANK 333 362 8.39e-3 SMART
ANK 366 395 3.76e-5 SMART
ANK 399 428 2.45e-4 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin domains and two IQ calmodulin-binding domains. The encoded protein may function in renal tubular development and function, and in left-right axis determination. This protein interacts with nephrocystin and infers a connection between primary cilia function and left-right axis determination. A similar protein in mice interacts with calmodulin. Mutations in this gene have been associated with nephronophthisis type 2. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Transgenic mice homozygous for an insertional mutation exhibit complete inversion of the L-R body axis, reversal of embryo turning, complex cardiac anomalies, an abnormally slow turbulent leftward nodal flow, and renal cyst formation. Most succumb to renal failure within 1 week of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik G A 8: 12,329,554 (GRCm39) G3D unknown Het
Aif1 A T 17: 35,390,549 (GRCm39) I67N probably damaging Het
Akap11 T C 14: 78,749,441 (GRCm39) D982G Het
Anpep A G 7: 79,476,385 (GRCm39) L827P probably damaging Het
Arhgef5 A T 6: 43,250,933 (GRCm39) K561N probably benign Het
Arsj T C 3: 126,158,493 (GRCm39) F24S probably benign Het
Bard1 T C 1: 71,069,995 (GRCm39) D661G probably damaging Het
Cc2d2b A G 19: 40,783,056 (GRCm39) I618V unknown Het
Cfap251 G T 5: 123,435,521 (GRCm39) E994* probably null Het
Cfap54 T A 10: 92,723,298 (GRCm39) probably null Het
Cfhr2 T A 1: 139,758,952 (GRCm39) I33F probably damaging Het
Dsc1 G A 18: 20,218,922 (GRCm39) H827Y probably damaging Het
Eif3i C T 4: 129,494,207 (GRCm39) D31N probably damaging Het
Eno1b A T 18: 48,179,878 (GRCm39) T19S probably damaging Het
Eva1a G A 6: 82,048,210 (GRCm39) W29* probably null Het
Evc T C 5: 37,458,111 (GRCm39) K803R unknown Het
F5 T A 1: 164,019,779 (GRCm39) N751K probably damaging Het
Fam120a A T 13: 49,102,723 (GRCm39) N177K probably benign Het
Farp2 T G 1: 93,495,219 (GRCm39) I164R probably benign Het
Gm20379 C T 13: 92,442,565 (GRCm39) P26L Het
Hmgcs2 T C 3: 98,209,940 (GRCm39) S433P probably damaging Het
Inava T C 1: 136,143,675 (GRCm39) D587G possibly damaging Het
Ints2 T C 11: 86,122,881 (GRCm39) T633A probably benign Het
Mef2c A C 13: 83,810,623 (GRCm39) D391A possibly damaging Het
Msh4 A C 3: 153,573,387 (GRCm39) S756A probably damaging Het
Mylk3 T C 8: 86,080,218 (GRCm39) T490A probably benign Het
Myo1b A T 1: 51,815,761 (GRCm39) probably null Het
Nsmce1 A G 7: 125,071,106 (GRCm39) S107P probably benign Het
Or52a24 T A 7: 103,381,474 (GRCm39) S114T probably damaging Het
Or5d43 T C 2: 88,105,039 (GRCm39) Y118C probably damaging Het
Pcdhb21 G A 18: 37,648,028 (GRCm39) D386N probably benign Het
Pcdhb22 T G 18: 37,652,155 (GRCm39) L208V probably benign Het
Pigu C T 2: 155,173,064 (GRCm39) probably null Het
Plcz1 T A 6: 139,936,474 (GRCm39) E585V probably damaging Het
Pnpla7 C A 2: 24,873,544 (GRCm39) C183* probably null Het
Pomgnt1 T C 4: 116,009,949 (GRCm39) V133A possibly damaging Het
Prl3d3 A G 13: 27,345,096 (GRCm39) Y156C probably benign Het
Prpf39 A G 12: 65,100,167 (GRCm39) D280G probably benign Het
Recql5 C A 11: 115,785,881 (GRCm39) A631S probably benign Het
Runx3 C A 4: 134,882,679 (GRCm39) N138K probably damaging Het
Scaper T C 9: 55,715,038 (GRCm39) D750G probably damaging Het
Slc16a3 T C 11: 120,847,853 (GRCm39) L347P probably damaging Het
Slc25a1 G T 16: 17,744,303 (GRCm39) Y209* probably null Het
Smad2 A G 18: 76,419,956 (GRCm39) S88G probably benign Het
Sorcs1 A G 19: 50,141,490 (GRCm39) C1125R probably benign Het
Spata21 T A 4: 140,822,614 (GRCm39) I140N probably benign Het
Speer3 A T 5: 13,843,348 (GRCm39) D85V probably benign Het
Spopfm1 A T 3: 94,173,780 (GRCm39) M259L probably benign Het
Stra6 A G 9: 58,058,528 (GRCm39) N463S possibly damaging Het
Tmem14a T G 1: 21,299,623 (GRCm39) probably null Het
Tsc1 T A 2: 28,577,088 (GRCm39) L1130Q possibly damaging Het
Ttn T C 2: 76,611,401 (GRCm39) D17377G possibly damaging Het
Utf1 A G 7: 139,524,046 (GRCm39) D87G probably damaging Het
Vmn2r6 G A 3: 64,447,372 (GRCm39) Q565* probably null Het
Vmn2r63 A T 7: 42,583,014 (GRCm39) M67K probably benign Het
Vmn2r90 T C 17: 17,933,510 (GRCm39) Y357H not run Het
Vmn2r97 A G 17: 19,148,470 (GRCm39) T122A probably benign Het
Wdhd1 T C 14: 47,488,248 (GRCm39) E753G probably benign Het
Wdr11 A G 7: 129,204,834 (GRCm39) N213S probably benign Het
Xdh A C 17: 74,233,205 (GRCm39) D207E probably damaging Het
Zfp281 T A 1: 136,554,678 (GRCm39) I552N possibly damaging Het
Zzef1 T A 11: 72,716,893 (GRCm39) I361K probably damaging Het
Other mutations in Invs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Invs APN 4 48,402,909 (GRCm39) missense probably damaging 0.98
IGL00487:Invs APN 4 48,407,689 (GRCm39) nonsense probably null
IGL01487:Invs APN 4 48,398,136 (GRCm39) missense probably benign 0.26
IGL01696:Invs APN 4 48,425,997 (GRCm39) missense probably damaging 1.00
IGL02238:Invs APN 4 48,390,029 (GRCm39) missense probably damaging 1.00
IGL03286:Invs APN 4 48,382,261 (GRCm39) missense probably benign 0.26
R0645:Invs UTSW 4 48,407,653 (GRCm39) missense probably benign 0.00
R0661:Invs UTSW 4 48,421,861 (GRCm39) missense probably benign
R0698:Invs UTSW 4 48,396,364 (GRCm39) missense probably benign 0.04
R0763:Invs UTSW 4 48,392,628 (GRCm39) missense possibly damaging 0.82
R1183:Invs UTSW 4 48,421,725 (GRCm39) missense possibly damaging 0.68
R1381:Invs UTSW 4 48,421,942 (GRCm39) nonsense probably null
R1511:Invs UTSW 4 48,382,148 (GRCm39) missense possibly damaging 0.82
R1843:Invs UTSW 4 48,422,035 (GRCm39) missense probably damaging 0.96
R1903:Invs UTSW 4 48,402,824 (GRCm39) splice site probably null
R1928:Invs UTSW 4 48,390,095 (GRCm39) missense probably damaging 1.00
R1990:Invs UTSW 4 48,392,599 (GRCm39) missense possibly damaging 0.88
R2063:Invs UTSW 4 48,396,287 (GRCm39) missense probably damaging 1.00
R2064:Invs UTSW 4 48,396,287 (GRCm39) missense probably damaging 1.00
R2065:Invs UTSW 4 48,396,287 (GRCm39) missense probably damaging 1.00
R2066:Invs UTSW 4 48,396,287 (GRCm39) missense probably damaging 1.00
R4744:Invs UTSW 4 48,397,609 (GRCm39) missense probably damaging 1.00
R4997:Invs UTSW 4 48,396,332 (GRCm39) missense probably damaging 0.98
R5011:Invs UTSW 4 48,421,807 (GRCm39) missense probably damaging 1.00
R5013:Invs UTSW 4 48,421,807 (GRCm39) missense probably damaging 1.00
R5083:Invs UTSW 4 48,396,307 (GRCm39) missense possibly damaging 0.90
R5184:Invs UTSW 4 48,283,242 (GRCm39) utr 5 prime probably benign
R5258:Invs UTSW 4 48,396,374 (GRCm39) missense possibly damaging 0.82
R5375:Invs UTSW 4 48,385,262 (GRCm39) missense probably benign 0.12
R5509:Invs UTSW 4 48,396,337 (GRCm39) missense probably damaging 1.00
R5560:Invs UTSW 4 48,416,084 (GRCm39) missense probably benign 0.00
R5748:Invs UTSW 4 48,307,823 (GRCm39) missense probably damaging 0.98
R5813:Invs UTSW 4 48,398,146 (GRCm39) missense probably damaging 0.98
R5840:Invs UTSW 4 48,396,284 (GRCm39) missense probably damaging 1.00
R5984:Invs UTSW 4 48,421,674 (GRCm39) missense probably benign 0.00
R6513:Invs UTSW 4 48,397,534 (GRCm39) missense possibly damaging 0.46
R6637:Invs UTSW 4 48,416,203 (GRCm39) splice site probably null
R6667:Invs UTSW 4 48,402,870 (GRCm39) missense possibly damaging 0.66
R6838:Invs UTSW 4 48,283,278 (GRCm39) missense possibly damaging 0.95
R6921:Invs UTSW 4 48,396,260 (GRCm39) missense possibly damaging 0.46
R6945:Invs UTSW 4 48,421,785 (GRCm39) missense probably benign 0.00
R7102:Invs UTSW 4 48,407,674 (GRCm39) missense probably benign 0.21
R7142:Invs UTSW 4 48,407,696 (GRCm39) missense probably damaging 1.00
R7263:Invs UTSW 4 48,396,381 (GRCm39) missense probably damaging 1.00
R7283:Invs UTSW 4 48,392,526 (GRCm39) splice site probably null
R7461:Invs UTSW 4 48,392,668 (GRCm39) missense probably damaging 1.00
R7581:Invs UTSW 4 48,421,909 (GRCm39) missense probably benign 0.00
R7613:Invs UTSW 4 48,392,668 (GRCm39) missense probably damaging 1.00
R7861:Invs UTSW 4 48,397,559 (GRCm39) missense possibly damaging 0.50
R8316:Invs UTSW 4 48,426,199 (GRCm39) missense possibly damaging 0.68
R8321:Invs UTSW 4 48,283,267 (GRCm39) missense probably benign 0.13
R8500:Invs UTSW 4 48,422,109 (GRCm39) missense probably damaging 1.00
R8544:Invs UTSW 4 48,397,598 (GRCm39) missense probably damaging 0.96
R9171:Invs UTSW 4 48,398,149 (GRCm39) missense possibly damaging 0.90
R9663:Invs UTSW 4 48,426,218 (GRCm39) missense probably damaging 1.00
X0026:Invs UTSW 4 48,398,221 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCACACAGGTGCTCTATTACCATG -3'
(R):5'- TTGGAGTAAGATCTTGGCAAACTC -3'

Sequencing Primer
(F):5'- GTAGAGATGTTCTCCACCACTGCAG -3'
(R):5'- GTAAGATCTTGGCAAACTCAAGATC -3'
Posted On 2019-10-17