Mutagenetix > Incidental Mutation

Incidental Mutation 'R7503:Invs'

581608

Institutional Source

Beutler Lab

Gene Symbol

Invs

Ensembl Gene

ENSMUSG00000028344

Gene Name

inversin

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.690) question?

Stock #

R7503 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

48279760-48431954 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 48396347 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 340 (T340M)

Ref Sequence

ENSEMBL: ENSMUSP00000030029 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030029] [ENSMUST00000143433]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000030029
AA Change: T340M

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000030029
Gene: ENSMUSG00000028344
AA Change: T340M

Domain	Start	End	E-Value	Type
ANK	47	76	2.66e-5	SMART
ANK	80	110	1.8e-2	SMART
ANK	113	144	1.63e0	SMART
ANK	148	177	6.46e-4	SMART
ANK	181	215	3.44e1	SMART
ANK	220	250	1.11e-2	SMART
ANK	254	285	2.07e-2	SMART
ANK	288	317	3.18e-3	SMART
ANK	321	350	3.91e-3	SMART
ANK	356	385	2.28e-4	SMART
ANK	389	418	8.39e-3	SMART
ANK	422	451	3.76e-5	SMART
ANK	455	484	2.45e-4	SMART
ANK	488	517	1.31e-4	SMART
ANK	523	553	6.71e-2	SMART
IQ	554	576	5.75e-2	SMART
low complexity region	589	607	N/A	INTRINSIC
IQ	913	935	2.46e-1	SMART
low complexity region	973	989	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000143433
AA Change: T284M

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000138580
Gene: ENSMUSG00000028344
AA Change: T284M

Domain	Start	End	E-Value	Type
ANK	47	76	2.66e-5	SMART
ANK	80	110	1.8e-2	SMART
ANK	113	144	1.63e0	SMART
ANK	164	194	1.11e-2	SMART
ANK	198	229	2.07e-2	SMART
ANK	232	261	3.18e-3	SMART
ANK	265	294	3.91e-3	SMART
ANK	300	329	2.28e-4	SMART
ANK	333	362	8.39e-3	SMART
ANK	366	395	3.76e-5	SMART
ANK	399	428	2.45e-4	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin domains and two IQ calmodulin-binding domains. The encoded protein may function in renal tubular development and function, and in left-right axis determination. This protein interacts with nephrocystin and infers a connection between primary cilia function and left-right axis determination. A similar protein in mice interacts with calmodulin. Mutations in this gene have been associated with nephronophthisis type 2. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Transgenic mice homozygous for an insertional mutation exhibit complete inversion of the L-R body axis, reversal of embryo turning, complex cardiac anomalies, an abnormally slow turbulent leftward nodal flow, and renal cyst formation. Most succumb to renal failure within 1 week of life. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730559C18Rik	T	C	1: 136,215,937	D587G	possibly damaging	Het
A230072I06Rik	G	A	8: 12,279,554	G3D	unknown	Het
Aif1	A	T	17: 35,171,573	I67N	probably damaging	Het
Akap11	T	C	14: 78,512,001	D982G		Het
Anpep	A	G	7: 79,826,637	L827P	probably damaging	Het
Arhgef5	A	T	6: 43,273,999	K561N	probably benign	Het
Arsj	T	C	3: 126,364,844	F24S	probably benign	Het
Bard1	T	C	1: 71,030,836	D661G	probably damaging	Het
Cc2d2b	A	G	19: 40,794,612	I618V	unknown	Het
Cfap54	T	A	10: 92,887,436		probably null	Het
Cfhr2	T	A	1: 139,831,214	I33F	probably damaging	Het
Dsc1	G	A	18: 20,085,865	H827Y	probably damaging	Het
Eif3i	C	T	4: 129,600,414	D31N	probably damaging	Het
Eno1b	A	T	18: 48,046,811	T19S	probably damaging	Het
Eva1a	G	A	6: 82,071,229	W29*	probably null	Het
Evc	T	C	5: 37,300,767	K803R	unknown	Het
F5	T	A	1: 164,192,210	N751K	probably damaging	Het
Fam120a	A	T	13: 48,949,247	N177K	probably benign	Het
Farp2	T	G	1: 93,567,497	I164R	probably benign	Het
Gm20379	C	T	13: 92,306,057	P26L		Het
Gm4778	A	T	3: 94,266,473	M259L	probably benign	Het
Hmgcs2	T	C	3: 98,302,624	S433P	probably damaging	Het
Ints2	T	C	11: 86,232,055	T633A	probably benign	Het
Mef2c	A	C	13: 83,662,504	D391A	possibly damaging	Het
Msh4	A	C	3: 153,867,750	S756A	probably damaging	Het
Mylk3	T	C	8: 85,353,589	T490A	probably benign	Het
Myo1b	A	T	1: 51,776,602		probably null	Het
Nsmce1	A	G	7: 125,471,934	S107P	probably benign	Het
Olfr1173	T	C	2: 88,274,695	Y118C	probably damaging	Het
Olfr628	T	A	7: 103,732,267	S114T	probably damaging	Het
Pcdhb21	G	A	18: 37,514,975	D386N	probably benign	Het
Pcdhb22	T	G	18: 37,519,102	L208V	probably benign	Het
Pigu	C	T	2: 155,331,144		probably null	Het
Plcz1	T	A	6: 139,990,748	E585V	probably damaging	Het
Pnpla7	C	A	2: 24,983,532	C183*	probably null	Het
Pomgnt1	T	C	4: 116,152,752	V133A	possibly damaging	Het
Prl3d3	A	G	13: 27,161,113	Y156C	probably benign	Het
Prpf39	A	G	12: 65,053,393	D280G	probably benign	Het
Recql5	C	A	11: 115,895,055	A631S	probably benign	Het
Runx3	C	A	4: 135,155,368	N138K	probably damaging	Het
Scaper	T	C	9: 55,807,754	D750G	probably damaging	Het
Slc16a3	T	C	11: 120,957,027	L347P	probably damaging	Het
Slc25a1	G	T	16: 17,926,439	Y209*	probably null	Het
Smad2	A	G	18: 76,286,885	S88G	probably benign	Het
Sorcs1	A	G	19: 50,153,052	C1125R	probably benign	Het
Spata21	T	A	4: 141,095,303	I140N	probably benign	Het
Speer3	A	T	5: 13,793,334	D85V	probably benign	Het
Stra6	A	G	9: 58,151,245	N463S	possibly damaging	Het
Tmem14a	T	G	1: 21,229,399		probably null	Het
Tsc1	T	A	2: 28,687,076	L1130Q	possibly damaging	Het
Ttn	T	C	2: 76,781,057	D17377G	possibly damaging	Het
Utf1	A	G	7: 139,944,133	D87G	probably damaging	Het
Vmn2r6	G	A	3: 64,539,951	Q565*	probably null	Het
Vmn2r63	A	T	7: 42,933,590	M67K	probably benign	Het
Vmn2r90	T	C	17: 17,713,248	Y357H	not run	Het
Vmn2r97	A	G	17: 18,928,208	T122A	probably benign	Het
Wdhd1	T	C	14: 47,250,791	E753G	probably benign	Het
Wdr11	A	G	7: 129,603,110	N213S	probably benign	Het
Wdr66	G	T	5: 123,297,458	E994*	probably null	Het
Xdh	A	C	17: 73,926,210	D207E	probably damaging	Het
Zfp281	T	A	1: 136,626,940	I552N	possibly damaging	Het
Zzef1	T	A	11: 72,826,067	I361K	probably damaging	Het

Other mutations in Invs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Invs	APN	4	48402909	missense	probably damaging	0.98
IGL00487:Invs	APN	4	48407689	nonsense	probably null
IGL01487:Invs	APN	4	48398136	missense	probably benign	0.26
IGL01696:Invs	APN	4	48425997	missense	probably damaging	1.00
IGL02238:Invs	APN	4	48390029	missense	probably damaging	1.00
IGL03286:Invs	APN	4	48382261	missense	probably benign	0.26
R0645:Invs	UTSW	4	48407653	missense	probably benign	0.00
R0661:Invs	UTSW	4	48421861	missense	probably benign
R0698:Invs	UTSW	4	48396364	missense	probably benign	0.04
R0763:Invs	UTSW	4	48392628	missense	possibly damaging	0.82
R1183:Invs	UTSW	4	48421725	missense	possibly damaging	0.68
R1381:Invs	UTSW	4	48421942	nonsense	probably null
R1511:Invs	UTSW	4	48382148	missense	possibly damaging	0.82
R1843:Invs	UTSW	4	48422035	missense	probably damaging	0.96
R1903:Invs	UTSW	4	48402824	splice site	probably null
R1928:Invs	UTSW	4	48390095	missense	probably damaging	1.00
R1990:Invs	UTSW	4	48392599	missense	possibly damaging	0.88
R2063:Invs	UTSW	4	48396287	missense	probably damaging	1.00
R2064:Invs	UTSW	4	48396287	missense	probably damaging	1.00
R2065:Invs	UTSW	4	48396287	missense	probably damaging	1.00
R2066:Invs	UTSW	4	48396287	missense	probably damaging	1.00
R4744:Invs	UTSW	4	48397609	missense	probably damaging	1.00
R4997:Invs	UTSW	4	48396332	missense	probably damaging	0.98
R5011:Invs	UTSW	4	48421807	missense	probably damaging	1.00
R5013:Invs	UTSW	4	48421807	missense	probably damaging	1.00
R5083:Invs	UTSW	4	48396307	missense	possibly damaging	0.90
R5184:Invs	UTSW	4	48283242	utr 5 prime	probably benign
R5258:Invs	UTSW	4	48396374	missense	possibly damaging	0.82
R5375:Invs	UTSW	4	48385262	missense	probably benign	0.12
R5509:Invs	UTSW	4	48396337	missense	probably damaging	1.00
R5560:Invs	UTSW	4	48416084	missense	probably benign	0.00
R5748:Invs	UTSW	4	48307823	missense	probably damaging	0.98
R5813:Invs	UTSW	4	48398146	missense	probably damaging	0.98
R5840:Invs	UTSW	4	48396284	missense	probably damaging	1.00
R5984:Invs	UTSW	4	48421674	missense	probably benign	0.00
R6513:Invs	UTSW	4	48397534	missense	possibly damaging	0.46
R6637:Invs	UTSW	4	48416203	splice site	probably null
R6667:Invs	UTSW	4	48402870	missense	possibly damaging	0.66
R6838:Invs	UTSW	4	48283278	missense	possibly damaging	0.95
R6921:Invs	UTSW	4	48396260	missense	possibly damaging	0.46
R6945:Invs	UTSW	4	48421785	missense	probably benign	0.00
R7102:Invs	UTSW	4	48407674	missense	probably benign	0.21
R7142:Invs	UTSW	4	48407696	missense	probably damaging	1.00
R7263:Invs	UTSW	4	48396381	missense	probably damaging	1.00
R7283:Invs	UTSW	4	48392526	splice site	probably null
R7461:Invs	UTSW	4	48392668	missense	probably damaging	1.00
R7581:Invs	UTSW	4	48421909	missense	probably benign	0.00
R7613:Invs	UTSW	4	48392668	missense	probably damaging	1.00
R7861:Invs	UTSW	4	48397559	missense	possibly damaging	0.50
R8316:Invs	UTSW	4	48426199	missense	possibly damaging	0.68
R8321:Invs	UTSW	4	48283267	missense	probably benign	0.13
R8500:Invs	UTSW	4	48422109	missense	probably damaging	1.00
R8544:Invs	UTSW	4	48397598	missense	probably damaging	0.96
R9171:Invs	UTSW	4	48398149	missense	possibly damaging	0.90
R9663:Invs	UTSW	4	48426218	missense	probably damaging	1.00
X0026:Invs	UTSW	4	48398221	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- CCACACAGGTGCTCTATTACCATG -3'
(R):5'- TTGGAGTAAGATCTTGGCAAACTC -3'

Sequencing Primer
(F):5'- GTAGAGATGTTCTCCACCACTGCAG -3'
(R):5'- GTAAGATCTTGGCAAACTCAAGATC -3'

Posted On

2019-10-17