Incidental Mutation 'R7503:Eif3i'
ID581610
Institutional Source Beutler Lab
Gene Symbol Eif3i
Ensembl Gene ENSMUSG00000028798
Gene Nameeukaryotic translation initiation factor 3, subunit I
SynonymsEif3s2, 36kDa, TRIP-1, D4Ertd632e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R7503 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location129591960-129600648 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 129600414 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 31 (D31N)
Ref Sequence ENSEMBL: ENSMUSP00000099653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102591] [ENSMUST00000102593] [ENSMUST00000127919] [ENSMUST00000129515] [ENSMUST00000135055] [ENSMUST00000135628] [ENSMUST00000137090] [ENSMUST00000150110] [ENSMUST00000151969] [ENSMUST00000152126] [ENSMUST00000172774] [ENSMUST00000173758] [ENSMUST00000173937] [ENSMUST00000174073] [ENSMUST00000174819] [ENSMUST00000181579]
Predicted Effect probably benign
Transcript: ENSMUST00000102591
SMART Domains Protein: ENSMUSP00000099651
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:TMEM234 11 126 2.1e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102593
AA Change: D31N

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099653
Gene: ENSMUSG00000028798
AA Change: D31N

DomainStartEndE-ValueType
WD40 1 38 1.1e1 SMART
WD40 41 80 1.07e-8 SMART
WD40 135 174 3.84e0 SMART
WD40 177 216 6.63e-5 SMART
Blast:WD40 219 257 2e-18 BLAST
WD40 274 313 3.75e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127919
SMART Domains Protein: ENSMUSP00000123153
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129515
SMART Domains Protein: ENSMUSP00000117184
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135055
SMART Domains Protein: ENSMUSP00000120776
Gene: ENSMUSG00000028798

DomainStartEndE-ValueType
WD40 2 32 1.54e0 SMART
Blast:WD40 35 78 1e-9 BLAST
WD40 87 126 3.84e0 SMART
WD40 129 163 8.25e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135628
SMART Domains Protein: ENSMUSP00000120682
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137090
SMART Domains Protein: ENSMUSP00000117568
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145345
SMART Domains Protein: ENSMUSP00000122893
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:TMEM234 6 56 2.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150110
SMART Domains Protein: ENSMUSP00000122513
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 58 1.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151969
SMART Domains Protein: ENSMUSP00000120878
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152126
SMART Domains Protein: ENSMUSP00000120224
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172774
SMART Domains Protein: ENSMUSP00000133502
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173758
SMART Domains Protein: ENSMUSP00000134588
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 117 3.2e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173937
SMART Domains Protein: ENSMUSP00000133412
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174073
SMART Domains Protein: ENSMUSP00000133325
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174610
SMART Domains Protein: ENSMUSP00000134104
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:TMEM234 6 57 3.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174819
SMART Domains Protein: ENSMUSP00000133695
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 57 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181579
SMART Domains Protein: ENSMUSP00000137989
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 124 4.4e-42 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T C 1: 136,215,937 D587G possibly damaging Het
A230072I06Rik G A 8: 12,279,554 G3D unknown Het
Aif1 A T 17: 35,171,573 I67N probably damaging Het
Akap11 T C 14: 78,512,001 D982G Het
Anpep A G 7: 79,826,637 L827P probably damaging Het
Arhgef5 A T 6: 43,273,999 K561N probably benign Het
Arsj T C 3: 126,364,844 F24S probably benign Het
Bard1 T C 1: 71,030,836 D661G probably damaging Het
Cc2d2b A G 19: 40,794,612 I618V unknown Het
Cfap54 T A 10: 92,887,436 probably null Het
Cfhr2 T A 1: 139,831,214 I33F probably damaging Het
Dsc1 G A 18: 20,085,865 H827Y probably damaging Het
Eno1b A T 18: 48,046,811 T19S probably damaging Het
Eva1a G A 6: 82,071,229 W29* probably null Het
Evc T C 5: 37,300,767 K803R unknown Het
F5 T A 1: 164,192,210 N751K probably damaging Het
Fam120a A T 13: 48,949,247 N177K probably benign Het
Farp2 T G 1: 93,567,497 I164R probably benign Het
Gm20379 C T 13: 92,306,057 P26L Het
Gm4778 A T 3: 94,266,473 M259L probably benign Het
Hmgcs2 T C 3: 98,302,624 S433P probably damaging Het
Ints2 T C 11: 86,232,055 T633A probably benign Het
Invs C T 4: 48,396,347 T340M probably damaging Het
Mef2c A C 13: 83,662,504 D391A possibly damaging Het
Msh4 A C 3: 153,867,750 S756A probably damaging Het
Mylk3 T C 8: 85,353,589 T490A probably benign Het
Myo1b A T 1: 51,776,602 probably null Het
Nsmce1 A G 7: 125,471,934 S107P probably benign Het
Olfr1173 T C 2: 88,274,695 Y118C probably damaging Het
Olfr628 T A 7: 103,732,267 S114T probably damaging Het
Pcdhb21 G A 18: 37,514,975 D386N probably benign Het
Pcdhb22 T G 18: 37,519,102 L208V probably benign Het
Pigu C T 2: 155,331,144 probably null Het
Plcz1 T A 6: 139,990,748 E585V probably damaging Het
Pnpla7 C A 2: 24,983,532 C183* probably null Het
Pomgnt1 T C 4: 116,152,752 V133A possibly damaging Het
Prl3d3 A G 13: 27,161,113 Y156C probably benign Het
Prpf39 A G 12: 65,053,393 D280G probably benign Het
Recql5 C A 11: 115,895,055 A631S probably benign Het
Runx3 C A 4: 135,155,368 N138K probably damaging Het
Scaper T C 9: 55,807,754 D750G probably damaging Het
Slc16a3 T C 11: 120,957,027 L347P probably damaging Het
Slc25a1 G T 16: 17,926,439 Y209* probably null Het
Smad2 A G 18: 76,286,885 S88G probably benign Het
Sorcs1 A G 19: 50,153,052 C1125R probably benign Het
Spata21 T A 4: 141,095,303 I140N probably benign Het
Speer3 A T 5: 13,793,334 D85V probably benign Het
Stra6 A G 9: 58,151,245 N463S possibly damaging Het
Tmem14a T G 1: 21,229,399 probably null Het
Tsc1 T A 2: 28,687,076 L1130Q possibly damaging Het
Ttn T C 2: 76,781,057 D17377G possibly damaging Het
Utf1 A G 7: 139,944,133 D87G probably damaging Het
Vmn2r6 G A 3: 64,539,951 Q565* probably null Het
Vmn2r63 A T 7: 42,933,590 M67K probably benign Het
Vmn2r90 T C 17: 17,713,248 Y357H not run Het
Vmn2r97 A G 17: 18,928,208 T122A probably benign Het
Wdhd1 T C 14: 47,250,791 E753G probably benign Het
Wdr11 A G 7: 129,603,110 N213S probably benign Het
Wdr66 G T 5: 123,297,458 E994* probably null Het
Xdh A C 17: 73,926,210 D207E probably damaging Het
Zfp281 T A 1: 136,626,940 I552N possibly damaging Het
Zzef1 T A 11: 72,826,067 I361K probably damaging Het
Other mutations in Eif3i
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Eif3i APN 4 129595069 missense probably benign
IGL02222:Eif3i APN 4 129592088 missense possibly damaging 0.89
IGL02975:Eif3i APN 4 129595312 missense probably damaging 0.99
R0683:Eif3i UTSW 4 129593535 missense probably benign 0.12
R0783:Eif3i UTSW 4 129592076 missense possibly damaging 0.85
R0920:Eif3i UTSW 4 129595257 splice site probably benign
R1251:Eif3i UTSW 4 129593385 missense probably damaging 1.00
R2132:Eif3i UTSW 4 129596926 missense probably benign 0.02
R2133:Eif3i UTSW 4 129596926 missense probably benign 0.02
R3978:Eif3i UTSW 4 129592336 missense probably damaging 1.00
R4781:Eif3i UTSW 4 129595273 missense probably benign 0.11
R4808:Eif3i UTSW 4 129592064 missense probably benign 0.15
R5096:Eif3i UTSW 4 129600444 missense probably damaging 0.97
R5335:Eif3i UTSW 4 129595186 missense probably benign 0.20
R6048:Eif3i UTSW 4 129593352 missense probably benign 0.01
R7087:Eif3i UTSW 4 129592311 missense probably damaging 1.00
RF012:Eif3i UTSW 4 129592079 missense probably damaging 1.00
RF019:Eif3i UTSW 4 129600465 missense probably damaging 1.00
Z1176:Eif3i UTSW 4 129600575 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AATGCTGTCGCCAACCTACC -3'
(R):5'- ATGAAAACGCCAGGCCCTTC -3'

Sequencing Primer
(F):5'- AACCTACCGCGGTATGGG -3'
(R):5'- ATCCGGAAGTCGTCCCTAGTC -3'
Posted On2019-10-17