Incidental Mutation 'R7503:Runx3'
ID581611
Institutional Source Beutler Lab
Gene Symbol Runx3
Ensembl Gene ENSMUSG00000070691
Gene Namerunt related transcription factor 3
SynonymsCbfa3, AML2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7503 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location135120652-135177990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 135155368 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 138 (N138K)
Ref Sequence ENSEMBL: ENSMUSP00000050353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056977] [ENSMUST00000119564]
Predicted Effect probably damaging
Transcript: ENSMUST00000056977
AA Change: N138K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050353
Gene: ENSMUSG00000070691
AA Change: N138K

DomainStartEndE-ValueType
Pfam:Runt 70 199 4.2e-75 PFAM
Pfam:RunxI 328 423 9.1e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119564
AA Change: N124K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113159
Gene: ENSMUSG00000070691
AA Change: N124K

DomainStartEndE-ValueType
Pfam:Runt 53 187 1.3e-81 PFAM
Pfam:RunxI 311 409 1.2e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the runt domain-containing family of transcription factors. A heterodimer of this protein and a beta subunit forms a complex that binds to the core DNA sequence 5'-PYGPYGGT-3' found in a number of enhancers and promoters, and can either activate or suppress transcription. It also interacts with other transcription factors. It functions as a tumor suppressor, and the gene is frequently deleted or transcriptionally silenced in cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Nullizygous mutations can lead to variable phenotypes, including postnatal lethality, ataxia, skeletal and behavioral defects, altered differentiation and function of T cells and dendritic cells, gastric hyperplasia, intestinal and lung inflammation, hair shape changes, and absent Langerhans cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T C 1: 136,215,937 D587G possibly damaging Het
A230072I06Rik G A 8: 12,279,554 G3D unknown Het
Aif1 A T 17: 35,171,573 I67N probably damaging Het
Akap11 T C 14: 78,512,001 D982G Het
Anpep A G 7: 79,826,637 L827P probably damaging Het
Arhgef5 A T 6: 43,273,999 K561N probably benign Het
Arsj T C 3: 126,364,844 F24S probably benign Het
Bard1 T C 1: 71,030,836 D661G probably damaging Het
Cc2d2b A G 19: 40,794,612 I618V unknown Het
Cfap54 T A 10: 92,887,436 probably null Het
Cfhr2 T A 1: 139,831,214 I33F probably damaging Het
Dsc1 G A 18: 20,085,865 H827Y probably damaging Het
Eif3i C T 4: 129,600,414 D31N probably damaging Het
Eno1b A T 18: 48,046,811 T19S probably damaging Het
Eva1a G A 6: 82,071,229 W29* probably null Het
Evc T C 5: 37,300,767 K803R unknown Het
F5 T A 1: 164,192,210 N751K probably damaging Het
Fam120a A T 13: 48,949,247 N177K probably benign Het
Farp2 T G 1: 93,567,497 I164R probably benign Het
Gm20379 C T 13: 92,306,057 P26L Het
Gm4778 A T 3: 94,266,473 M259L probably benign Het
Hmgcs2 T C 3: 98,302,624 S433P probably damaging Het
Ints2 T C 11: 86,232,055 T633A probably benign Het
Invs C T 4: 48,396,347 T340M probably damaging Het
Mef2c A C 13: 83,662,504 D391A possibly damaging Het
Msh4 A C 3: 153,867,750 S756A probably damaging Het
Mylk3 T C 8: 85,353,589 T490A probably benign Het
Myo1b A T 1: 51,776,602 probably null Het
Nsmce1 A G 7: 125,471,934 S107P probably benign Het
Olfr1173 T C 2: 88,274,695 Y118C probably damaging Het
Olfr628 T A 7: 103,732,267 S114T probably damaging Het
Pcdhb21 G A 18: 37,514,975 D386N probably benign Het
Pcdhb22 T G 18: 37,519,102 L208V probably benign Het
Pigu C T 2: 155,331,144 probably null Het
Plcz1 T A 6: 139,990,748 E585V probably damaging Het
Pnpla7 C A 2: 24,983,532 C183* probably null Het
Pomgnt1 T C 4: 116,152,752 V133A possibly damaging Het
Prl3d3 A G 13: 27,161,113 Y156C probably benign Het
Prpf39 A G 12: 65,053,393 D280G probably benign Het
Recql5 C A 11: 115,895,055 A631S probably benign Het
Scaper T C 9: 55,807,754 D750G probably damaging Het
Slc16a3 T C 11: 120,957,027 L347P probably damaging Het
Slc25a1 G T 16: 17,926,439 Y209* probably null Het
Smad2 A G 18: 76,286,885 S88G probably benign Het
Sorcs1 A G 19: 50,153,052 C1125R probably benign Het
Spata21 T A 4: 141,095,303 I140N probably benign Het
Speer3 A T 5: 13,793,334 D85V probably benign Het
Stra6 A G 9: 58,151,245 N463S possibly damaging Het
Tmem14a T G 1: 21,229,399 probably null Het
Tsc1 T A 2: 28,687,076 L1130Q possibly damaging Het
Ttn T C 2: 76,781,057 D17377G possibly damaging Het
Utf1 A G 7: 139,944,133 D87G probably damaging Het
Vmn2r6 G A 3: 64,539,951 Q565* probably null Het
Vmn2r63 A T 7: 42,933,590 M67K probably benign Het
Vmn2r90 T C 17: 17,713,248 Y357H not run Het
Vmn2r97 A G 17: 18,928,208 T122A probably benign Het
Wdhd1 T C 14: 47,250,791 E753G probably benign Het
Wdr11 A G 7: 129,603,110 N213S probably benign Het
Wdr66 G T 5: 123,297,458 E994* probably null Het
Xdh A C 17: 73,926,210 D207E probably damaging Het
Zfp281 T A 1: 136,626,940 I552N possibly damaging Het
Zzef1 T A 11: 72,826,067 I361K probably damaging Het
Other mutations in Runx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02455:Runx3 APN 4 135175530 missense probably damaging 1.00
R2111:Runx3 UTSW 4 135155316 missense probably damaging 1.00
R4975:Runx3 UTSW 4 135171135 missense probably benign 0.00
R5164:Runx3 UTSW 4 135121130 missense possibly damaging 0.93
R5786:Runx3 UTSW 4 135163264 missense probably damaging 1.00
R7193:Runx3 UTSW 4 135121145 missense probably benign
R7212:Runx3 UTSW 4 135152779 missense probably damaging 0.99
Z1177:Runx3 UTSW 4 135152886 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GTATTGGGAACGGATCTACACG -3'
(R):5'- ACATAAAAGGGTGGCACTGC -3'

Sequencing Primer
(F):5'- GATCTACACGCGGTTAAGCCTC -3'
(R):5'- CCTACCGGGCCTTGCTGAG -3'
Posted On2019-10-17