Incidental Mutation 'R7503:Evc'
ID581614
Institutional Source Beutler Lab
Gene Symbol Evc
Ensembl Gene ENSMUSG00000029122
Gene NameEvC ciliary complex subunit 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R7503 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location37289098-37336894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37300767 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 803 (K803R)
Ref Sequence ENSEMBL: ENSMUSP00000109791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031005] [ENSMUST00000114154] [ENSMUST00000146568]
Predicted Effect probably benign
Transcript: ENSMUST00000031005
SMART Domains Protein: ENSMUSP00000031005
Gene: ENSMUSG00000029122

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 77 92 N/A INTRINSIC
low complexity region 173 183 N/A INTRINSIC
low complexity region 449 472 N/A INTRINSIC
low complexity region 640 652 N/A INTRINSIC
low complexity region 670 682 N/A INTRINSIC
coiled coil region 694 725 N/A INTRINSIC
low complexity region 772 786 N/A INTRINSIC
coiled coil region 871 911 N/A INTRINSIC
low complexity region 927 944 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000114154
AA Change: K803R
SMART Domains Protein: ENSMUSP00000109791
Gene: ENSMUSG00000029122
AA Change: K803R

DomainStartEndE-ValueType
low complexity region 272 295 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
low complexity region 493 505 N/A INTRINSIC
coiled coil region 517 548 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
coiled coil region 694 734 N/A INTRINSIC
low complexity region 750 767 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000120191
Gene: ENSMUSG00000029122
AA Change: K71R

DomainStartEndE-ValueType
low complexity region 19 36 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146568
SMART Domains Protein: ENSMUSP00000114825
Gene: ENSMUSG00000029122

DomainStartEndE-ValueType
coiled coil region 23 63 N/A INTRINSIC
low complexity region 79 96 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a leucine zipper and a transmembrane domain. This gene has been implicated in both Ellis-van Creveld syndrome (EvC) and Weyers acrodental dysostosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some lethality shortly after birth and exhibit aphagia, infertile, teeth abnormalities, short limbs and long bones, delays in ossification, and short ribs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T C 1: 136,215,937 D587G possibly damaging Het
A230072I06Rik G A 8: 12,279,554 G3D unknown Het
Aif1 A T 17: 35,171,573 I67N probably damaging Het
Akap11 T C 14: 78,512,001 D982G Het
Anpep A G 7: 79,826,637 L827P probably damaging Het
Arhgef5 A T 6: 43,273,999 K561N probably benign Het
Arsj T C 3: 126,364,844 F24S probably benign Het
Bard1 T C 1: 71,030,836 D661G probably damaging Het
Cc2d2b A G 19: 40,794,612 I618V unknown Het
Cfap54 T A 10: 92,887,436 probably null Het
Cfhr2 T A 1: 139,831,214 I33F probably damaging Het
Dsc1 G A 18: 20,085,865 H827Y probably damaging Het
Eif3i C T 4: 129,600,414 D31N probably damaging Het
Eno1b A T 18: 48,046,811 T19S probably damaging Het
Eva1a G A 6: 82,071,229 W29* probably null Het
F5 T A 1: 164,192,210 N751K probably damaging Het
Fam120a A T 13: 48,949,247 N177K probably benign Het
Farp2 T G 1: 93,567,497 I164R probably benign Het
Gm20379 C T 13: 92,306,057 P26L Het
Gm4778 A T 3: 94,266,473 M259L probably benign Het
Hmgcs2 T C 3: 98,302,624 S433P probably damaging Het
Ints2 T C 11: 86,232,055 T633A probably benign Het
Invs C T 4: 48,396,347 T340M probably damaging Het
Mef2c A C 13: 83,662,504 D391A possibly damaging Het
Msh4 A C 3: 153,867,750 S756A probably damaging Het
Mylk3 T C 8: 85,353,589 T490A probably benign Het
Myo1b A T 1: 51,776,602 probably null Het
Nsmce1 A G 7: 125,471,934 S107P probably benign Het
Olfr1173 T C 2: 88,274,695 Y118C probably damaging Het
Olfr628 T A 7: 103,732,267 S114T probably damaging Het
Pcdhb21 G A 18: 37,514,975 D386N probably benign Het
Pcdhb22 T G 18: 37,519,102 L208V probably benign Het
Pigu C T 2: 155,331,144 probably null Het
Plcz1 T A 6: 139,990,748 E585V probably damaging Het
Pnpla7 C A 2: 24,983,532 C183* probably null Het
Pomgnt1 T C 4: 116,152,752 V133A possibly damaging Het
Prl3d3 A G 13: 27,161,113 Y156C probably benign Het
Prpf39 A G 12: 65,053,393 D280G probably benign Het
Recql5 C A 11: 115,895,055 A631S probably benign Het
Runx3 C A 4: 135,155,368 N138K probably damaging Het
Scaper T C 9: 55,807,754 D750G probably damaging Het
Slc16a3 T C 11: 120,957,027 L347P probably damaging Het
Slc25a1 G T 16: 17,926,439 Y209* probably null Het
Smad2 A G 18: 76,286,885 S88G probably benign Het
Sorcs1 A G 19: 50,153,052 C1125R probably benign Het
Spata21 T A 4: 141,095,303 I140N probably benign Het
Speer3 A T 5: 13,793,334 D85V probably benign Het
Stra6 A G 9: 58,151,245 N463S possibly damaging Het
Tmem14a T G 1: 21,229,399 probably null Het
Tsc1 T A 2: 28,687,076 L1130Q possibly damaging Het
Ttn T C 2: 76,781,057 D17377G possibly damaging Het
Utf1 A G 7: 139,944,133 D87G probably damaging Het
Vmn2r6 G A 3: 64,539,951 Q565* probably null Het
Vmn2r63 A T 7: 42,933,590 M67K probably benign Het
Vmn2r90 T C 17: 17,713,248 Y357H not run Het
Vmn2r97 A G 17: 18,928,208 T122A probably benign Het
Wdhd1 T C 14: 47,250,791 E753G probably benign Het
Wdr11 A G 7: 129,603,110 N213S probably benign Het
Wdr66 G T 5: 123,297,458 E994* probably null Het
Xdh A C 17: 73,926,210 D207E probably damaging Het
Zfp281 T A 1: 136,626,940 I552N possibly damaging Het
Zzef1 T A 11: 72,826,067 I361K probably damaging Het
Other mutations in Evc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Evc APN 5 37333013 missense probably damaging 1.00
IGL01799:Evc APN 5 37324914 missense possibly damaging 0.46
IGL01806:Evc APN 5 37320234 critical splice donor site probably null
IGL01823:Evc APN 5 37328521 missense probably damaging 1.00
IGL02821:Evc APN 5 37326396 missense probably benign 0.01
R0312:Evc UTSW 5 37328541 missense possibly damaging 0.83
R0355:Evc UTSW 5 37316312 splice site probably benign
R0741:Evc UTSW 5 37326395 missense possibly damaging 0.51
R0745:Evc UTSW 5 37319059 missense probably damaging 0.99
R1498:Evc UTSW 5 37323700 missense possibly damaging 0.66
R1517:Evc UTSW 5 37319035 missense probably damaging 1.00
R2680:Evc UTSW 5 37310237 missense probably benign
R2867:Evc UTSW 5 37316275 intron probably benign
R4585:Evc UTSW 5 37323713 missense probably damaging 0.96
R4586:Evc UTSW 5 37323713 missense probably damaging 0.96
R4731:Evc UTSW 5 37323797 missense probably benign 0.38
R4859:Evc UTSW 5 37300909 missense probably damaging 0.96
R4963:Evc UTSW 5 37322049 critical splice donor site probably null
R5536:Evc UTSW 5 37326583 splice site probably benign
R5693:Evc UTSW 5 37320240 missense possibly damaging 0.46
R5781:Evc UTSW 5 37326570 missense probably damaging 1.00
R6251:Evc UTSW 5 37300499 missense probably benign
R7061:Evc UTSW 5 37319102 missense possibly damaging 0.66
R7286:Evc UTSW 5 37322183 nonsense probably null
R7831:Evc UTSW 5 37319083 missense probably damaging 1.00
R8344:Evc UTSW 5 37314528 missense possibly damaging 0.90
X0012:Evc UTSW 5 37300729 intron probably benign
Predicted Primers PCR Primer
(F):5'- CCCAGTGCCAGAGGATAATG -3'
(R):5'- AGGAAGTGCCATCTAAAGTCG -3'

Sequencing Primer
(F):5'- TAATGGCTCAGTTGACCCAG -3'
(R):5'- TCTAAAGTCGTGAAGCCATCCTGG -3'
Posted On2019-10-17