Incidental Mutation 'R7503:Arhgef5'
ID 581616
Institutional Source Beutler Lab
Gene Symbol Arhgef5
Ensembl Gene ENSMUSG00000033542
Gene Name Rho guanine nucleotide exchange factor 5
Synonyms 2210412D05Rik
MMRRC Submission 045576-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7503 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 43242578-43266254 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 43250933 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 561 (K561N)
Ref Sequence ENSEMBL: ENSMUSP00000031750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031750]
AlphaFold E9Q7D5
Predicted Effect probably benign
Transcript: ENSMUST00000031750
AA Change: K561N

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: K561N

DomainStartEndE-ValueType
Pfam:ARHGEF5_35 1 477 3.1e-220 PFAM
low complexity region 509 531 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 827 851 N/A INTRINSIC
RhoGEF 1162 1341 2.97e-57 SMART
PH 1375 1488 1.11e-6 SMART
SH3 1497 1554 6.39e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182924
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik G A 8: 12,329,554 (GRCm39) G3D unknown Het
Aif1 A T 17: 35,390,549 (GRCm39) I67N probably damaging Het
Akap11 T C 14: 78,749,441 (GRCm39) D982G Het
Anpep A G 7: 79,476,385 (GRCm39) L827P probably damaging Het
Arsj T C 3: 126,158,493 (GRCm39) F24S probably benign Het
Bard1 T C 1: 71,069,995 (GRCm39) D661G probably damaging Het
Cc2d2b A G 19: 40,783,056 (GRCm39) I618V unknown Het
Cfap251 G T 5: 123,435,521 (GRCm39) E994* probably null Het
Cfap54 T A 10: 92,723,298 (GRCm39) probably null Het
Cfhr2 T A 1: 139,758,952 (GRCm39) I33F probably damaging Het
Dsc1 G A 18: 20,218,922 (GRCm39) H827Y probably damaging Het
Eif3i C T 4: 129,494,207 (GRCm39) D31N probably damaging Het
Eno1b A T 18: 48,179,878 (GRCm39) T19S probably damaging Het
Eva1a G A 6: 82,048,210 (GRCm39) W29* probably null Het
Evc T C 5: 37,458,111 (GRCm39) K803R unknown Het
F5 T A 1: 164,019,779 (GRCm39) N751K probably damaging Het
Fam120a A T 13: 49,102,723 (GRCm39) N177K probably benign Het
Farp2 T G 1: 93,495,219 (GRCm39) I164R probably benign Het
Gm20379 C T 13: 92,442,565 (GRCm39) P26L Het
Hmgcs2 T C 3: 98,209,940 (GRCm39) S433P probably damaging Het
Inava T C 1: 136,143,675 (GRCm39) D587G possibly damaging Het
Ints2 T C 11: 86,122,881 (GRCm39) T633A probably benign Het
Invs C T 4: 48,396,347 (GRCm39) T340M probably damaging Het
Mef2c A C 13: 83,810,623 (GRCm39) D391A possibly damaging Het
Msh4 A C 3: 153,573,387 (GRCm39) S756A probably damaging Het
Mylk3 T C 8: 86,080,218 (GRCm39) T490A probably benign Het
Myo1b A T 1: 51,815,761 (GRCm39) probably null Het
Nsmce1 A G 7: 125,071,106 (GRCm39) S107P probably benign Het
Or52a24 T A 7: 103,381,474 (GRCm39) S114T probably damaging Het
Or5d43 T C 2: 88,105,039 (GRCm39) Y118C probably damaging Het
Pcdhb21 G A 18: 37,648,028 (GRCm39) D386N probably benign Het
Pcdhb22 T G 18: 37,652,155 (GRCm39) L208V probably benign Het
Pigu C T 2: 155,173,064 (GRCm39) probably null Het
Plcz1 T A 6: 139,936,474 (GRCm39) E585V probably damaging Het
Pnpla7 C A 2: 24,873,544 (GRCm39) C183* probably null Het
Pomgnt1 T C 4: 116,009,949 (GRCm39) V133A possibly damaging Het
Prl3d3 A G 13: 27,345,096 (GRCm39) Y156C probably benign Het
Prpf39 A G 12: 65,100,167 (GRCm39) D280G probably benign Het
Recql5 C A 11: 115,785,881 (GRCm39) A631S probably benign Het
Runx3 C A 4: 134,882,679 (GRCm39) N138K probably damaging Het
Scaper T C 9: 55,715,038 (GRCm39) D750G probably damaging Het
Slc16a3 T C 11: 120,847,853 (GRCm39) L347P probably damaging Het
Slc25a1 G T 16: 17,744,303 (GRCm39) Y209* probably null Het
Smad2 A G 18: 76,419,956 (GRCm39) S88G probably benign Het
Sorcs1 A G 19: 50,141,490 (GRCm39) C1125R probably benign Het
Spata21 T A 4: 140,822,614 (GRCm39) I140N probably benign Het
Speer3 A T 5: 13,843,348 (GRCm39) D85V probably benign Het
Spopfm1 A T 3: 94,173,780 (GRCm39) M259L probably benign Het
Stra6 A G 9: 58,058,528 (GRCm39) N463S possibly damaging Het
Tmem14a T G 1: 21,299,623 (GRCm39) probably null Het
Tsc1 T A 2: 28,577,088 (GRCm39) L1130Q possibly damaging Het
Ttn T C 2: 76,611,401 (GRCm39) D17377G possibly damaging Het
Utf1 A G 7: 139,524,046 (GRCm39) D87G probably damaging Het
Vmn2r6 G A 3: 64,447,372 (GRCm39) Q565* probably null Het
Vmn2r63 A T 7: 42,583,014 (GRCm39) M67K probably benign Het
Vmn2r90 T C 17: 17,933,510 (GRCm39) Y357H not run Het
Vmn2r97 A G 17: 19,148,470 (GRCm39) T122A probably benign Het
Wdhd1 T C 14: 47,488,248 (GRCm39) E753G probably benign Het
Wdr11 A G 7: 129,204,834 (GRCm39) N213S probably benign Het
Xdh A C 17: 74,233,205 (GRCm39) D207E probably damaging Het
Zfp281 T A 1: 136,554,678 (GRCm39) I552N possibly damaging Het
Zzef1 T A 11: 72,716,893 (GRCm39) I361K probably damaging Het
Other mutations in Arhgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Arhgef5 APN 6 43,257,203 (GRCm39) nonsense probably null
IGL01341:Arhgef5 APN 6 43,260,925 (GRCm39) missense probably damaging 1.00
IGL01576:Arhgef5 APN 6 43,250,962 (GRCm39) missense probably benign 0.38
IGL01761:Arhgef5 APN 6 43,251,538 (GRCm39) missense probably benign 0.00
IGL02104:Arhgef5 APN 6 43,249,345 (GRCm39) missense probably damaging 0.99
IGL02208:Arhgef5 APN 6 43,252,064 (GRCm39) missense probably benign 0.11
IGL02487:Arhgef5 APN 6 43,260,916 (GRCm39) missense probably damaging 1.00
IGL02650:Arhgef5 APN 6 43,249,869 (GRCm39) nonsense probably null
IGL03292:Arhgef5 APN 6 43,257,180 (GRCm39) missense probably damaging 1.00
IGL03334:Arhgef5 APN 6 43,250,934 (GRCm39) missense possibly damaging 0.47
IGL03341:Arhgef5 APN 6 43,257,585 (GRCm39) missense probably damaging 0.99
R0047:Arhgef5 UTSW 6 43,242,555 (GRCm39) splice site probably null
R0206:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R0208:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R0698:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R1145:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R1145:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R1168:Arhgef5 UTSW 6 43,250,330 (GRCm39) missense probably benign 0.00
R1355:Arhgef5 UTSW 6 43,260,846 (GRCm39) missense probably damaging 1.00
R1370:Arhgef5 UTSW 6 43,260,846 (GRCm39) missense probably damaging 1.00
R1481:Arhgef5 UTSW 6 43,251,568 (GRCm39) missense probably damaging 0.99
R1529:Arhgef5 UTSW 6 43,256,449 (GRCm39) missense probably damaging 0.96
R1532:Arhgef5 UTSW 6 43,250,337 (GRCm39) missense probably benign
R1663:Arhgef5 UTSW 6 43,253,899 (GRCm39) missense probably damaging 1.00
R1742:Arhgef5 UTSW 6 43,257,133 (GRCm39) missense probably damaging 1.00
R1852:Arhgef5 UTSW 6 43,252,119 (GRCm39) missense probably benign 0.00
R1869:Arhgef5 UTSW 6 43,265,616 (GRCm39) missense probably damaging 1.00
R1880:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R2146:Arhgef5 UTSW 6 43,260,252 (GRCm39) missense probably damaging 1.00
R2169:Arhgef5 UTSW 6 43,251,354 (GRCm39) missense probably benign 0.11
R3412:Arhgef5 UTSW 6 43,250,724 (GRCm39) missense probably benign
R4205:Arhgef5 UTSW 6 43,250,766 (GRCm39) missense possibly damaging 0.76
R4226:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4227:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4304:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4308:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4457:Arhgef5 UTSW 6 43,251,027 (GRCm39) missense probably damaging 1.00
R4469:Arhgef5 UTSW 6 43,252,033 (GRCm39) missense probably benign
R4636:Arhgef5 UTSW 6 43,251,876 (GRCm39) missense probably benign 0.11
R4791:Arhgef5 UTSW 6 43,260,117 (GRCm39) missense probably damaging 1.00
R4818:Arhgef5 UTSW 6 43,250,484 (GRCm39) missense probably benign 0.00
R4910:Arhgef5 UTSW 6 43,249,762 (GRCm39) missense probably benign 0.01
R4911:Arhgef5 UTSW 6 43,249,762 (GRCm39) missense probably benign 0.01
R5127:Arhgef5 UTSW 6 43,250,148 (GRCm39) missense probably damaging 0.99
R5209:Arhgef5 UTSW 6 43,250,634 (GRCm39) missense probably benign 0.01
R5245:Arhgef5 UTSW 6 43,242,614 (GRCm39) start gained probably benign
R5251:Arhgef5 UTSW 6 43,249,815 (GRCm39) missense possibly damaging 0.76
R5513:Arhgef5 UTSW 6 43,249,273 (GRCm39) missense probably damaging 0.96
R5613:Arhgef5 UTSW 6 43,250,997 (GRCm39) missense probably benign 0.01
R5616:Arhgef5 UTSW 6 43,252,874 (GRCm39) missense probably benign 0.20
R5817:Arhgef5 UTSW 6 43,252,038 (GRCm39) missense probably benign 0.15
R6024:Arhgef5 UTSW 6 43,252,068 (GRCm39) missense probably benign 0.00
R6735:Arhgef5 UTSW 6 43,251,966 (GRCm39) missense probably benign 0.01
R6825:Arhgef5 UTSW 6 43,251,895 (GRCm39) missense probably damaging 0.99
R6831:Arhgef5 UTSW 6 43,257,933 (GRCm39) missense probably damaging 1.00
R6901:Arhgef5 UTSW 6 43,250,232 (GRCm39) missense probably benign 0.00
R6932:Arhgef5 UTSW 6 43,251,351 (GRCm39) missense possibly damaging 0.94
R6968:Arhgef5 UTSW 6 43,252,276 (GRCm39) missense probably benign 0.00
R7018:Arhgef5 UTSW 6 43,265,665 (GRCm39) missense probably damaging 1.00
R7180:Arhgef5 UTSW 6 43,252,142 (GRCm39) missense possibly damaging 0.87
R7201:Arhgef5 UTSW 6 43,250,166 (GRCm39) nonsense probably null
R7358:Arhgef5 UTSW 6 43,256,507 (GRCm39) missense probably damaging 1.00
R7359:Arhgef5 UTSW 6 43,257,216 (GRCm39) missense probably damaging 1.00
R7468:Arhgef5 UTSW 6 43,257,605 (GRCm39) nonsense probably null
R7699:Arhgef5 UTSW 6 43,251,691 (GRCm39) missense probably benign 0.11
R7700:Arhgef5 UTSW 6 43,251,691 (GRCm39) missense probably benign 0.11
R7737:Arhgef5 UTSW 6 43,250,728 (GRCm39) missense possibly damaging 0.84
R7847:Arhgef5 UTSW 6 43,252,069 (GRCm39) nonsense probably null
R7950:Arhgef5 UTSW 6 43,250,859 (GRCm39) missense possibly damaging 0.76
R8161:Arhgef5 UTSW 6 43,260,885 (GRCm39) missense probably damaging 1.00
R8178:Arhgef5 UTSW 6 43,252,119 (GRCm39) missense probably benign 0.00
R8203:Arhgef5 UTSW 6 43,257,579 (GRCm39) missense probably damaging 1.00
R8318:Arhgef5 UTSW 6 43,252,933 (GRCm39) critical splice donor site probably null
R8857:Arhgef5 UTSW 6 43,264,558 (GRCm39) missense probably damaging 1.00
R9499:Arhgef5 UTSW 6 43,260,940 (GRCm39) missense
R9610:Arhgef5 UTSW 6 43,257,890 (GRCm39) missense probably damaging 0.99
R9611:Arhgef5 UTSW 6 43,257,890 (GRCm39) missense probably damaging 0.99
R9623:Arhgef5 UTSW 6 43,251,736 (GRCm39) missense possibly damaging 0.86
R9685:Arhgef5 UTSW 6 43,250,527 (GRCm39) missense probably benign 0.11
RF023:Arhgef5 UTSW 6 43,256,407 (GRCm39) missense probably damaging 1.00
X0028:Arhgef5 UTSW 6 43,250,635 (GRCm39) missense probably benign 0.03
X0065:Arhgef5 UTSW 6 43,249,342 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCTTCAGGGACACGAGATTC -3'
(R):5'- TCTTCTTGGGGTCAGAGAGC -3'

Sequencing Primer
(F):5'- TTCAGGGACACGAGATTCACCTC -3'
(R):5'- GGCCTCTGAGGTAATTCCAAATG -3'
Posted On 2019-10-17