Mutagenetix > Incidental Mutations

Incidental Mutation 'R7503:Arhgef5'

581616

Institutional Source

Beutler Lab

Gene Symbol

Arhgef5

Ensembl Gene

ENSMUSG00000033542

Gene Name

Rho guanine nucleotide exchange factor (GEF) 5

Synonyms

2210412D05Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7503 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43265582-43289320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 43273999 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 561 (K561N)

Ref Sequence

ENSEMBL: ENSMUSP00000031750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031750]

Predicted Effect

probably benign
Transcript: ENSMUST00000031750
AA Change: K561N

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: K561N

Domain	Start	End	E-Value	Type
Pfam:ARHGEF5_35	1	477	3.1e-220	PFAM
low complexity region	509	531	N/A	INTRINSIC
low complexity region	812	825	N/A	INTRINSIC
low complexity region	827	851	N/A	INTRINSIC
RhoGEF	1162	1341	2.97e-57	SMART
PH	1375	1488	1.11e-6	SMART
SH3	1497	1554	6.39e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000182924

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730559C18Rik	T	C	1: 136,215,937	D587G	possibly damaging	Het
A230072I06Rik	G	A	8: 12,279,554	G3D	unknown	Het
Aif1	A	T	17: 35,171,573	I67N	probably damaging	Het
Akap11	T	C	14: 78,512,001	D982G		Het
Anpep	A	G	7: 79,826,637	L827P	probably damaging	Het
Arsj	T	C	3: 126,364,844	F24S	probably benign	Het
Bard1	T	C	1: 71,030,836	D661G	probably damaging	Het
Cc2d2b	A	G	19: 40,794,612	I618V	unknown	Het
Cfap54	T	A	10: 92,887,436		probably null	Het
Cfhr2	T	A	1: 139,831,214	I33F	probably damaging	Het
Dsc1	G	A	18: 20,085,865	H827Y	probably damaging	Het
Eif3i	C	T	4: 129,600,414	D31N	probably damaging	Het
Eno1b	A	T	18: 48,046,811	T19S	probably damaging	Het
Eva1a	G	A	6: 82,071,229	W29*	probably null	Het
Evc	T	C	5: 37,300,767	K803R	unknown	Het
F5	T	A	1: 164,192,210	N751K	probably damaging	Het
Fam120a	A	T	13: 48,949,247	N177K	probably benign	Het
Farp2	T	G	1: 93,567,497	I164R	probably benign	Het
Gm20379	C	T	13: 92,306,057	P26L		Het
Gm4778	A	T	3: 94,266,473	M259L	probably benign	Het
Hmgcs2	T	C	3: 98,302,624	S433P	probably damaging	Het
Ints2	T	C	11: 86,232,055	T633A	probably benign	Het
Invs	C	T	4: 48,396,347	T340M	probably damaging	Het
Mef2c	A	C	13: 83,662,504	D391A	possibly damaging	Het
Msh4	A	C	3: 153,867,750	S756A	probably damaging	Het
Mylk3	T	C	8: 85,353,589	T490A	probably benign	Het
Myo1b	A	T	1: 51,776,602		probably null	Het
Nsmce1	A	G	7: 125,471,934	S107P	probably benign	Het
Olfr1173	T	C	2: 88,274,695	Y118C	probably damaging	Het
Olfr628	T	A	7: 103,732,267	S114T	probably damaging	Het
Pcdhb21	G	A	18: 37,514,975	D386N	probably benign	Het
Pcdhb22	T	G	18: 37,519,102	L208V	probably benign	Het
Pigu	C	T	2: 155,331,144		probably null	Het
Plcz1	T	A	6: 139,990,748	E585V	probably damaging	Het
Pnpla7	C	A	2: 24,983,532	C183*	probably null	Het
Pomgnt1	T	C	4: 116,152,752	V133A	possibly damaging	Het
Prl3d3	A	G	13: 27,161,113	Y156C	probably benign	Het
Prpf39	A	G	12: 65,053,393	D280G	probably benign	Het
Recql5	C	A	11: 115,895,055	A631S	probably benign	Het
Runx3	C	A	4: 135,155,368	N138K	probably damaging	Het
Scaper	T	C	9: 55,807,754	D750G	probably damaging	Het
Slc16a3	T	C	11: 120,957,027	L347P	probably damaging	Het
Slc25a1	G	T	16: 17,926,439	Y209*	probably null	Het
Smad2	A	G	18: 76,286,885	S88G	probably benign	Het
Sorcs1	A	G	19: 50,153,052	C1125R	probably benign	Het
Spata21	T	A	4: 141,095,303	I140N	probably benign	Het
Speer3	A	T	5: 13,793,334	D85V	probably benign	Het
Stra6	A	G	9: 58,151,245	N463S	possibly damaging	Het
Tmem14a	T	G	1: 21,229,399		probably null	Het
Tsc1	T	A	2: 28,687,076	L1130Q	possibly damaging	Het
Ttn	T	C	2: 76,781,057	D17377G	possibly damaging	Het
Utf1	A	G	7: 139,944,133	D87G	probably damaging	Het
Vmn2r6	G	A	3: 64,539,951	Q565*	probably null	Het
Vmn2r63	A	T	7: 42,933,590	M67K	probably benign	Het
Vmn2r90	T	C	17: 17,713,248	Y357H	not run	Het
Vmn2r97	A	G	17: 18,928,208	T122A	probably benign	Het
Wdhd1	T	C	14: 47,250,791	E753G	probably benign	Het
Wdr11	A	G	7: 129,603,110	N213S	probably benign	Het
Wdr66	G	T	5: 123,297,458	E994*	probably null	Het
Xdh	A	C	17: 73,926,210	D207E	probably damaging	Het
Zfp281	T	A	1: 136,626,940	I552N	possibly damaging	Het
Zzef1	T	A	11: 72,826,067	I361K	probably damaging	Het

Other mutations in Arhgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Arhgef5	APN	6	43280269	nonsense	probably null
IGL01341:Arhgef5	APN	6	43283991	missense	probably damaging	1.00
IGL01576:Arhgef5	APN	6	43274028	missense	probably benign	0.38
IGL01761:Arhgef5	APN	6	43274604	missense	probably benign	0.00
IGL02104:Arhgef5	APN	6	43272411	missense	probably damaging	0.99
IGL02208:Arhgef5	APN	6	43275130	missense	probably benign	0.11
IGL02487:Arhgef5	APN	6	43283982	missense	probably damaging	1.00
IGL02650:Arhgef5	APN	6	43272935	nonsense	probably null
IGL03292:Arhgef5	APN	6	43280246	missense	probably damaging	1.00
IGL03334:Arhgef5	APN	6	43274000	missense	possibly damaging	0.47
IGL03341:Arhgef5	APN	6	43280651	missense	probably damaging	0.99
R0047:Arhgef5	UTSW	6	43265621	splice site	probably null
R0206:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0208:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0698:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1168:Arhgef5	UTSW	6	43273396	missense	probably benign	0.00
R1355:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1370:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1481:Arhgef5	UTSW	6	43274634	missense	probably damaging	0.99
R1529:Arhgef5	UTSW	6	43279515	missense	probably damaging	0.96
R1532:Arhgef5	UTSW	6	43273403	missense	probably benign
R1663:Arhgef5	UTSW	6	43276965	missense	probably damaging	1.00
R1742:Arhgef5	UTSW	6	43280199	missense	probably damaging	1.00
R1852:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R1869:Arhgef5	UTSW	6	43288682	missense	probably damaging	1.00
R1880:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R2146:Arhgef5	UTSW	6	43283318	missense	probably damaging	1.00
R2169:Arhgef5	UTSW	6	43274420	missense	probably benign	0.11
R3412:Arhgef5	UTSW	6	43273790	missense	probably benign
R4205:Arhgef5	UTSW	6	43273832	missense	possibly damaging	0.76
R4226:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4227:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4304:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4308:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4457:Arhgef5	UTSW	6	43274093	missense	probably damaging	1.00
R4469:Arhgef5	UTSW	6	43275099	missense	probably benign
R4636:Arhgef5	UTSW	6	43274942	missense	probably benign	0.11
R4791:Arhgef5	UTSW	6	43283183	missense	probably damaging	1.00
R4818:Arhgef5	UTSW	6	43273550	missense	probably benign	0.00
R4910:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R4911:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R5127:Arhgef5	UTSW	6	43273214	missense	probably damaging	0.99
R5209:Arhgef5	UTSW	6	43273700	missense	probably benign	0.01
R5245:Arhgef5	UTSW	6	43265680	start gained	probably benign
R5251:Arhgef5	UTSW	6	43272881	missense	possibly damaging	0.76
R5513:Arhgef5	UTSW	6	43272339	missense	probably damaging	0.96
R5613:Arhgef5	UTSW	6	43274063	missense	probably benign	0.01
R5616:Arhgef5	UTSW	6	43275940	missense	probably benign	0.20
R5817:Arhgef5	UTSW	6	43275104	missense	probably benign	0.15
R6024:Arhgef5	UTSW	6	43275134	missense	probably benign	0.00
R6735:Arhgef5	UTSW	6	43275032	missense	probably benign	0.01
R6825:Arhgef5	UTSW	6	43274961	missense	probably damaging	0.99
R6831:Arhgef5	UTSW	6	43280999	missense	probably damaging	1.00
R6901:Arhgef5	UTSW	6	43273298	missense	probably benign	0.00
R6932:Arhgef5	UTSW	6	43274417	missense	possibly damaging	0.94
R6968:Arhgef5	UTSW	6	43275342	missense	probably benign	0.00
R7018:Arhgef5	UTSW	6	43288731	missense	probably damaging	1.00
R7180:Arhgef5	UTSW	6	43275208	missense	possibly damaging	0.87
R7201:Arhgef5	UTSW	6	43273232	nonsense	probably null
R7358:Arhgef5	UTSW	6	43279573	missense	probably damaging	1.00
R7359:Arhgef5	UTSW	6	43280282	missense	probably damaging	1.00
R7468:Arhgef5	UTSW	6	43280671	nonsense	probably null
R7699:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7700:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7737:Arhgef5	UTSW	6	43273794	missense	possibly damaging	0.84
R7847:Arhgef5	UTSW	6	43275135	nonsense	probably null
R7950:Arhgef5	UTSW	6	43273925	missense	possibly damaging	0.76
R8161:Arhgef5	UTSW	6	43283951	missense	probably damaging	1.00
R8178:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R8203:Arhgef5	UTSW	6	43280645	missense	probably damaging	1.00
R8318:Arhgef5	UTSW	6	43275999	critical splice donor site	probably null
RF023:Arhgef5	UTSW	6	43279473	missense	probably damaging	1.00
X0028:Arhgef5	UTSW	6	43273701	missense	probably benign	0.03
X0065:Arhgef5	UTSW	6	43272408	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TCCTTCAGGGACACGAGATTC -3'
(R):5'- TCTTCTTGGGGTCAGAGAGC -3'

Sequencing Primer
(F):5'- TTCAGGGACACGAGATTCACCTC -3'
(R):5'- GGCCTCTGAGGTAATTCCAAATG -3'

Posted On

2019-10-17