Incidental Mutation 'R7503:Plcz1'
ID581618
Institutional Source Beutler Lab
Gene Symbol Plcz1
Ensembl Gene ENSMUSG00000030230
Gene Namephospholipase C, zeta 1
Synonyms1700041H07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7503 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location139989673-140041457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139990748 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 585 (E585V)
Ref Sequence ENSEMBL: ENSMUSP00000032356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032356] [ENSMUST00000129986] [ENSMUST00000137148]
Predicted Effect probably damaging
Transcript: ENSMUST00000032356
AA Change: E585V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032356
Gene: ENSMUSG00000030230
AA Change: E585V

DomainStartEndE-ValueType
Pfam:EF-hand_like 80 162 9.6e-26 PFAM
PLCXc 163 307 5.17e-72 SMART
low complexity region 374 385 N/A INTRINSIC
PLCYc 386 502 1.52e-51 SMART
C2 521 625 2.06e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129986
Predicted Effect probably benign
Transcript: ENSMUST00000137148
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the phosphoinositide-specific phospholipase C family. Members in this family, classified into six isotypes that are tissue- and organ-specific, hydrolyze phosphatidylinositol 4,5-bisphosphate just before the phosphate group to yield diacylglycerol and inositol 1,4,5-trisphosphate. This protein localizes to the acrosome in spermatozoa and elicits Ca(2+) oscillations and egg activation during fertilization that leads to early embryonic development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygous knockout mice display normal spermatogenesis and sperm motility but are sub-fertile because of a failure to induce Ca2+ oscillations in oocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T C 1: 136,215,937 D587G possibly damaging Het
A230072I06Rik G A 8: 12,279,554 G3D unknown Het
Aif1 A T 17: 35,171,573 I67N probably damaging Het
Akap11 T C 14: 78,512,001 D982G Het
Anpep A G 7: 79,826,637 L827P probably damaging Het
Arhgef5 A T 6: 43,273,999 K561N probably benign Het
Arsj T C 3: 126,364,844 F24S probably benign Het
Bard1 T C 1: 71,030,836 D661G probably damaging Het
Cc2d2b A G 19: 40,794,612 I618V unknown Het
Cfap54 T A 10: 92,887,436 probably null Het
Cfhr2 T A 1: 139,831,214 I33F probably damaging Het
Dsc1 G A 18: 20,085,865 H827Y probably damaging Het
Eif3i C T 4: 129,600,414 D31N probably damaging Het
Eno1b A T 18: 48,046,811 T19S probably damaging Het
Eva1a G A 6: 82,071,229 W29* probably null Het
Evc T C 5: 37,300,767 K803R unknown Het
F5 T A 1: 164,192,210 N751K probably damaging Het
Fam120a A T 13: 48,949,247 N177K probably benign Het
Farp2 T G 1: 93,567,497 I164R probably benign Het
Gm20379 C T 13: 92,306,057 P26L Het
Gm4778 A T 3: 94,266,473 M259L probably benign Het
Hmgcs2 T C 3: 98,302,624 S433P probably damaging Het
Ints2 T C 11: 86,232,055 T633A probably benign Het
Invs C T 4: 48,396,347 T340M probably damaging Het
Mef2c A C 13: 83,662,504 D391A possibly damaging Het
Msh4 A C 3: 153,867,750 S756A probably damaging Het
Mylk3 T C 8: 85,353,589 T490A probably benign Het
Myo1b A T 1: 51,776,602 probably null Het
Nsmce1 A G 7: 125,471,934 S107P probably benign Het
Olfr1173 T C 2: 88,274,695 Y118C probably damaging Het
Olfr628 T A 7: 103,732,267 S114T probably damaging Het
Pcdhb21 G A 18: 37,514,975 D386N probably benign Het
Pcdhb22 T G 18: 37,519,102 L208V probably benign Het
Pigu C T 2: 155,331,144 probably null Het
Pnpla7 C A 2: 24,983,532 C183* probably null Het
Pomgnt1 T C 4: 116,152,752 V133A possibly damaging Het
Prl3d3 A G 13: 27,161,113 Y156C probably benign Het
Prpf39 A G 12: 65,053,393 D280G probably benign Het
Recql5 C A 11: 115,895,055 A631S probably benign Het
Runx3 C A 4: 135,155,368 N138K probably damaging Het
Scaper T C 9: 55,807,754 D750G probably damaging Het
Slc16a3 T C 11: 120,957,027 L347P probably damaging Het
Slc25a1 G T 16: 17,926,439 Y209* probably null Het
Smad2 A G 18: 76,286,885 S88G probably benign Het
Sorcs1 A G 19: 50,153,052 C1125R probably benign Het
Spata21 T A 4: 141,095,303 I140N probably benign Het
Speer3 A T 5: 13,793,334 D85V probably benign Het
Stra6 A G 9: 58,151,245 N463S possibly damaging Het
Tmem14a T G 1: 21,229,399 probably null Het
Tsc1 T A 2: 28,687,076 L1130Q possibly damaging Het
Ttn T C 2: 76,781,057 D17377G possibly damaging Het
Utf1 A G 7: 139,944,133 D87G probably damaging Het
Vmn2r6 G A 3: 64,539,951 Q565* probably null Het
Vmn2r63 A T 7: 42,933,590 M67K probably benign Het
Vmn2r90 T C 17: 17,713,248 Y357H not run Het
Vmn2r97 A G 17: 18,928,208 T122A probably benign Het
Wdhd1 T C 14: 47,250,791 E753G probably benign Het
Wdr11 A G 7: 129,603,110 N213S probably benign Het
Wdr66 G T 5: 123,297,458 E994* probably null Het
Xdh A C 17: 73,926,210 D207E probably damaging Het
Zfp281 T A 1: 136,626,940 I552N possibly damaging Het
Zzef1 T A 11: 72,826,067 I361K probably damaging Het
Other mutations in Plcz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Plcz1 APN 6 140002256 splice site probably benign
IGL01825:Plcz1 APN 6 140003916 missense probably benign 0.03
IGL01885:Plcz1 APN 6 140002111 missense probably benign 0.14
IGL02539:Plcz1 APN 6 139992964 missense probably benign 0.06
IGL02754:Plcz1 APN 6 140010581 missense probably benign 0.00
IGL03379:Plcz1 APN 6 139990764 missense possibly damaging 0.69
IGL03412:Plcz1 APN 6 140016097 missense probably damaging 0.99
helium UTSW 6 140016127 missense probably damaging 1.00
R0005:Plcz1 UTSW 6 140040564 splice site probably benign
R0034:Plcz1 UTSW 6 140020448 utr 3 prime probably benign
R0078:Plcz1 UTSW 6 139989784 missense probably damaging 1.00
R0142:Plcz1 UTSW 6 140007697 missense probably damaging 1.00
R0200:Plcz1 UTSW 6 139990733 missense probably damaging 1.00
R0399:Plcz1 UTSW 6 140023230 missense possibly damaging 0.95
R0599:Plcz1 UTSW 6 140028542 missense probably benign
R0608:Plcz1 UTSW 6 139990733 missense probably damaging 1.00
R1854:Plcz1 UTSW 6 139993049 missense probably benign 0.36
R2212:Plcz1 UTSW 6 140002081 missense probably damaging 0.98
R2895:Plcz1 UTSW 6 140023151 missense possibly damaging 0.79
R3413:Plcz1 UTSW 6 140002081 missense probably damaging 0.98
R4239:Plcz1 UTSW 6 140040618 unclassified probably null
R4441:Plcz1 UTSW 6 139990687 missense probably benign 0.00
R4889:Plcz1 UTSW 6 140007748 missense probably benign 0.00
R4953:Plcz1 UTSW 6 140028551 missense possibly damaging 0.89
R5175:Plcz1 UTSW 6 140039663 missense possibly damaging 0.94
R5359:Plcz1 UTSW 6 140028452 missense probably damaging 1.00
R5401:Plcz1 UTSW 6 139993052 splice site probably null
R5505:Plcz1 UTSW 6 140016216 missense probably damaging 0.99
R5558:Plcz1 UTSW 6 140039755 missense probably damaging 1.00
R5581:Plcz1 UTSW 6 140023125 missense probably damaging 1.00
R6252:Plcz1 UTSW 6 140007603 critical splice donor site probably null
R6569:Plcz1 UTSW 6 140007707 missense possibly damaging 0.62
R6750:Plcz1 UTSW 6 140028438 missense possibly damaging 0.74
R7073:Plcz1 UTSW 6 140023123 nonsense probably null
R7204:Plcz1 UTSW 6 140010424 missense probably benign 0.05
R7309:Plcz1 UTSW 6 140023156 missense probably damaging 1.00
R7446:Plcz1 UTSW 6 140013586 missense possibly damaging 0.63
R7634:Plcz1 UTSW 6 140016127 missense probably damaging 1.00
Z1176:Plcz1 UTSW 6 140013676 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TGGTGTGATCCAAGTGCAGC -3'
(R):5'- GTTATAACATCTTCCACTCACTGAC -3'

Sequencing Primer
(F):5'- TCCAAGTGCAGCTTTGATAGAG -3'
(R):5'- CTTCCACTCACTGACTACATTAAATG -3'
Posted On2019-10-17