Incidental Mutation 'R7503:Utf1'
ID581624
Institutional Source Beutler Lab
Gene Symbol Utf1
Ensembl Gene ENSMUSG00000047751
Gene Nameundifferentiated embryonic cell transcription factor 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.659) question?
Stock #R7503 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location139943789-139945112 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139944133 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 87 (D87G)
Ref Sequence ENSEMBL: ENSMUSP00000128848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445] [ENSMUST00000168457]
Predicted Effect probably benign
Transcript: ENSMUST00000053445
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168457
AA Change: D87G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128848
Gene: ENSMUSG00000047751
AA Change: D87G

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:Myb_DNA-bind_4 60 139 1e-9 PFAM
low complexity region 156 194 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
SCOP:d1e7la2 246 314 1e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a leucine zipper-containing transcriptional coactivator that may link the upstream activator ATF2 with the basal transcription complex. The encoded protein is closely associated with chromatin and is required for the proper differentiation of embryonic carcinoma and embryonic stem cells. Found nearly exclusively in pluripotent cells, this protein can also serve as a transcriptional repressor. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth retardation and background sensitive neo- and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T C 1: 136,215,937 D587G possibly damaging Het
A230072I06Rik G A 8: 12,279,554 G3D unknown Het
Aif1 A T 17: 35,171,573 I67N probably damaging Het
Akap11 T C 14: 78,512,001 D982G Het
Anpep A G 7: 79,826,637 L827P probably damaging Het
Arhgef5 A T 6: 43,273,999 K561N probably benign Het
Arsj T C 3: 126,364,844 F24S probably benign Het
Bard1 T C 1: 71,030,836 D661G probably damaging Het
Cc2d2b A G 19: 40,794,612 I618V unknown Het
Cfap54 T A 10: 92,887,436 probably null Het
Cfhr2 T A 1: 139,831,214 I33F probably damaging Het
Dsc1 G A 18: 20,085,865 H827Y probably damaging Het
Eif3i C T 4: 129,600,414 D31N probably damaging Het
Eno1b A T 18: 48,046,811 T19S probably damaging Het
Eva1a G A 6: 82,071,229 W29* probably null Het
Evc T C 5: 37,300,767 K803R unknown Het
F5 T A 1: 164,192,210 N751K probably damaging Het
Fam120a A T 13: 48,949,247 N177K probably benign Het
Farp2 T G 1: 93,567,497 I164R probably benign Het
Gm20379 C T 13: 92,306,057 P26L Het
Gm4778 A T 3: 94,266,473 M259L probably benign Het
Hmgcs2 T C 3: 98,302,624 S433P probably damaging Het
Ints2 T C 11: 86,232,055 T633A probably benign Het
Invs C T 4: 48,396,347 T340M probably damaging Het
Mef2c A C 13: 83,662,504 D391A possibly damaging Het
Msh4 A C 3: 153,867,750 S756A probably damaging Het
Mylk3 T C 8: 85,353,589 T490A probably benign Het
Myo1b A T 1: 51,776,602 probably null Het
Nsmce1 A G 7: 125,471,934 S107P probably benign Het
Olfr1173 T C 2: 88,274,695 Y118C probably damaging Het
Olfr628 T A 7: 103,732,267 S114T probably damaging Het
Pcdhb21 G A 18: 37,514,975 D386N probably benign Het
Pcdhb22 T G 18: 37,519,102 L208V probably benign Het
Pigu C T 2: 155,331,144 probably null Het
Plcz1 T A 6: 139,990,748 E585V probably damaging Het
Pnpla7 C A 2: 24,983,532 C183* probably null Het
Pomgnt1 T C 4: 116,152,752 V133A possibly damaging Het
Prl3d3 A G 13: 27,161,113 Y156C probably benign Het
Prpf39 A G 12: 65,053,393 D280G probably benign Het
Recql5 C A 11: 115,895,055 A631S probably benign Het
Runx3 C A 4: 135,155,368 N138K probably damaging Het
Scaper T C 9: 55,807,754 D750G probably damaging Het
Slc16a3 T C 11: 120,957,027 L347P probably damaging Het
Slc25a1 G T 16: 17,926,439 Y209* probably null Het
Smad2 A G 18: 76,286,885 S88G probably benign Het
Sorcs1 A G 19: 50,153,052 C1125R probably benign Het
Spata21 T A 4: 141,095,303 I140N probably benign Het
Speer3 A T 5: 13,793,334 D85V probably benign Het
Stra6 A G 9: 58,151,245 N463S possibly damaging Het
Tmem14a T G 1: 21,229,399 probably null Het
Tsc1 T A 2: 28,687,076 L1130Q possibly damaging Het
Ttn T C 2: 76,781,057 D17377G possibly damaging Het
Vmn2r6 G A 3: 64,539,951 Q565* probably null Het
Vmn2r63 A T 7: 42,933,590 M67K probably benign Het
Vmn2r90 T C 17: 17,713,248 Y357H not run Het
Vmn2r97 A G 17: 18,928,208 T122A probably benign Het
Wdhd1 T C 14: 47,250,791 E753G probably benign Het
Wdr11 A G 7: 129,603,110 N213S probably benign Het
Wdr66 G T 5: 123,297,458 E994* probably null Het
Xdh A C 17: 73,926,210 D207E probably damaging Het
Zfp281 T A 1: 136,626,940 I552N possibly damaging Het
Zzef1 T A 11: 72,826,067 I361K probably damaging Het
Other mutations in Utf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02510:Utf1 APN 7 139944016 nonsense probably null
IGL02988:Utf1 UTSW 7 139943962 missense possibly damaging 0.92
R1813:Utf1 UTSW 7 139944300 missense probably damaging 0.96
R1896:Utf1 UTSW 7 139944300 missense probably damaging 0.96
R2079:Utf1 UTSW 7 139944895 nonsense probably null
R2176:Utf1 UTSW 7 139944007 missense possibly damaging 0.92
R5052:Utf1 UTSW 7 139944901 unclassified probably benign
R5554:Utf1 UTSW 7 139943946 missense probably benign
R5754:Utf1 UTSW 7 139944791 unclassified probably benign
R7910:Utf1 UTSW 7 139944791 unclassified probably benign
R7991:Utf1 UTSW 7 139944791 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTGACTACGTCTGATGCCTTCG -3'
(R):5'- ACATGGCTGCTCCTACCTTG -3'

Sequencing Primer
(F):5'- GATGCCTTCGCTACTTCGGG -3'
(R):5'- CAATAGCCCCATGAGTTGGC -3'
Posted On2019-10-17