Incidental Mutation 'R7503:Ints2'
ID 581630
Institutional Source Beutler Lab
Gene Symbol Ints2
Ensembl Gene ENSMUSG00000018068
Gene Name integrator complex subunit 2
Synonyms 2810417D08Rik
MMRRC Submission 045576-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7503 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 86101507-86148401 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86122881 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 633 (T633A)
Ref Sequence ENSEMBL: ENSMUSP00000018212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]
AlphaFold Q80UK8
Predicted Effect probably benign
Transcript: ENSMUST00000018212
AA Change: T633A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: T633A

DomainStartEndE-ValueType
Pfam:INTS2 24 1131 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108039
AA Change: T633A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: T633A

DomainStartEndE-ValueType
Pfam:INTS2 24 1132 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134828
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik G A 8: 12,329,554 (GRCm39) G3D unknown Het
Aif1 A T 17: 35,390,549 (GRCm39) I67N probably damaging Het
Akap11 T C 14: 78,749,441 (GRCm39) D982G Het
Anpep A G 7: 79,476,385 (GRCm39) L827P probably damaging Het
Arhgef5 A T 6: 43,250,933 (GRCm39) K561N probably benign Het
Arsj T C 3: 126,158,493 (GRCm39) F24S probably benign Het
Bard1 T C 1: 71,069,995 (GRCm39) D661G probably damaging Het
Cc2d2b A G 19: 40,783,056 (GRCm39) I618V unknown Het
Cfap251 G T 5: 123,435,521 (GRCm39) E994* probably null Het
Cfap54 T A 10: 92,723,298 (GRCm39) probably null Het
Cfhr2 T A 1: 139,758,952 (GRCm39) I33F probably damaging Het
Dsc1 G A 18: 20,218,922 (GRCm39) H827Y probably damaging Het
Eif3i C T 4: 129,494,207 (GRCm39) D31N probably damaging Het
Eno1b A T 18: 48,179,878 (GRCm39) T19S probably damaging Het
Eva1a G A 6: 82,048,210 (GRCm39) W29* probably null Het
Evc T C 5: 37,458,111 (GRCm39) K803R unknown Het
F5 T A 1: 164,019,779 (GRCm39) N751K probably damaging Het
Fam120a A T 13: 49,102,723 (GRCm39) N177K probably benign Het
Farp2 T G 1: 93,495,219 (GRCm39) I164R probably benign Het
Gm20379 C T 13: 92,442,565 (GRCm39) P26L Het
Hmgcs2 T C 3: 98,209,940 (GRCm39) S433P probably damaging Het
Inava T C 1: 136,143,675 (GRCm39) D587G possibly damaging Het
Invs C T 4: 48,396,347 (GRCm39) T340M probably damaging Het
Mef2c A C 13: 83,810,623 (GRCm39) D391A possibly damaging Het
Msh4 A C 3: 153,573,387 (GRCm39) S756A probably damaging Het
Mylk3 T C 8: 86,080,218 (GRCm39) T490A probably benign Het
Myo1b A T 1: 51,815,761 (GRCm39) probably null Het
Nsmce1 A G 7: 125,071,106 (GRCm39) S107P probably benign Het
Or52a24 T A 7: 103,381,474 (GRCm39) S114T probably damaging Het
Or5d43 T C 2: 88,105,039 (GRCm39) Y118C probably damaging Het
Pcdhb21 G A 18: 37,648,028 (GRCm39) D386N probably benign Het
Pcdhb22 T G 18: 37,652,155 (GRCm39) L208V probably benign Het
Pigu C T 2: 155,173,064 (GRCm39) probably null Het
Plcz1 T A 6: 139,936,474 (GRCm39) E585V probably damaging Het
Pnpla7 C A 2: 24,873,544 (GRCm39) C183* probably null Het
Pomgnt1 T C 4: 116,009,949 (GRCm39) V133A possibly damaging Het
Prl3d3 A G 13: 27,345,096 (GRCm39) Y156C probably benign Het
Prpf39 A G 12: 65,100,167 (GRCm39) D280G probably benign Het
Recql5 C A 11: 115,785,881 (GRCm39) A631S probably benign Het
Runx3 C A 4: 134,882,679 (GRCm39) N138K probably damaging Het
Scaper T C 9: 55,715,038 (GRCm39) D750G probably damaging Het
Slc16a3 T C 11: 120,847,853 (GRCm39) L347P probably damaging Het
Slc25a1 G T 16: 17,744,303 (GRCm39) Y209* probably null Het
Smad2 A G 18: 76,419,956 (GRCm39) S88G probably benign Het
Sorcs1 A G 19: 50,141,490 (GRCm39) C1125R probably benign Het
Spata21 T A 4: 140,822,614 (GRCm39) I140N probably benign Het
Speer3 A T 5: 13,843,348 (GRCm39) D85V probably benign Het
Spopfm1 A T 3: 94,173,780 (GRCm39) M259L probably benign Het
Stra6 A G 9: 58,058,528 (GRCm39) N463S possibly damaging Het
Tmem14a T G 1: 21,299,623 (GRCm39) probably null Het
Tsc1 T A 2: 28,577,088 (GRCm39) L1130Q possibly damaging Het
Ttn T C 2: 76,611,401 (GRCm39) D17377G possibly damaging Het
Utf1 A G 7: 139,524,046 (GRCm39) D87G probably damaging Het
Vmn2r6 G A 3: 64,447,372 (GRCm39) Q565* probably null Het
Vmn2r63 A T 7: 42,583,014 (GRCm39) M67K probably benign Het
Vmn2r90 T C 17: 17,933,510 (GRCm39) Y357H not run Het
Vmn2r97 A G 17: 19,148,470 (GRCm39) T122A probably benign Het
Wdhd1 T C 14: 47,488,248 (GRCm39) E753G probably benign Het
Wdr11 A G 7: 129,204,834 (GRCm39) N213S probably benign Het
Xdh A C 17: 74,233,205 (GRCm39) D207E probably damaging Het
Zfp281 T A 1: 136,554,678 (GRCm39) I552N possibly damaging Het
Zzef1 T A 11: 72,716,893 (GRCm39) I361K probably damaging Het
Other mutations in Ints2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ints2 APN 11 86,123,961 (GRCm39) missense probably damaging 1.00
IGL02490:Ints2 APN 11 86,124,009 (GRCm39) missense possibly damaging 0.93
IGL02612:Ints2 APN 11 86,106,404 (GRCm39) missense probably damaging 1.00
IGL03396:Ints2 APN 11 86,103,888 (GRCm39) missense probably damaging 0.99
R0015:Ints2 UTSW 11 86,140,113 (GRCm39) missense probably damaging 1.00
R0015:Ints2 UTSW 11 86,140,113 (GRCm39) missense probably damaging 1.00
R0355:Ints2 UTSW 11 86,125,575 (GRCm39) missense probably benign 0.00
R0389:Ints2 UTSW 11 86,139,677 (GRCm39) missense probably damaging 1.00
R0631:Ints2 UTSW 11 86,124,022 (GRCm39) missense probably benign 0.02
R0944:Ints2 UTSW 11 86,135,289 (GRCm39) missense possibly damaging 0.85
R1268:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1269:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1270:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1396:Ints2 UTSW 11 86,140,074 (GRCm39) missense probably damaging 0.98
R1474:Ints2 UTSW 11 86,117,607 (GRCm39) missense probably damaging 0.97
R1503:Ints2 UTSW 11 86,117,607 (GRCm39) missense probably damaging 0.97
R1840:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1987:Ints2 UTSW 11 86,108,626 (GRCm39) missense probably benign 0.03
R1990:Ints2 UTSW 11 86,139,760 (GRCm39) missense possibly damaging 0.58
R1991:Ints2 UTSW 11 86,139,760 (GRCm39) missense possibly damaging 0.58
R3694:Ints2 UTSW 11 86,133,827 (GRCm39) missense probably benign 0.41
R4056:Ints2 UTSW 11 86,133,778 (GRCm39) missense probably damaging 1.00
R4057:Ints2 UTSW 11 86,133,778 (GRCm39) missense probably damaging 1.00
R4569:Ints2 UTSW 11 86,147,024 (GRCm39) missense probably damaging 1.00
R4585:Ints2 UTSW 11 86,140,101 (GRCm39) missense probably damaging 1.00
R4586:Ints2 UTSW 11 86,140,101 (GRCm39) missense probably damaging 1.00
R4806:Ints2 UTSW 11 86,147,035 (GRCm39) missense probably benign 0.10
R4929:Ints2 UTSW 11 86,103,479 (GRCm39) missense possibly damaging 0.56
R5031:Ints2 UTSW 11 86,147,026 (GRCm39) missense probably damaging 1.00
R5064:Ints2 UTSW 11 86,140,100 (GRCm39) missense probably damaging 1.00
R5270:Ints2 UTSW 11 86,106,621 (GRCm39) missense probably damaging 1.00
R5621:Ints2 UTSW 11 86,133,773 (GRCm39) missense probably benign 0.32
R5875:Ints2 UTSW 11 86,129,138 (GRCm39) missense probably benign 0.04
R5908:Ints2 UTSW 11 86,106,371 (GRCm39) critical splice donor site probably null
R5914:Ints2 UTSW 11 86,113,000 (GRCm39) missense probably benign 0.03
R5941:Ints2 UTSW 11 86,141,798 (GRCm39) missense probably benign 0.01
R5975:Ints2 UTSW 11 86,117,574 (GRCm39) missense possibly damaging 0.72
R6003:Ints2 UTSW 11 86,129,294 (GRCm39) missense probably damaging 1.00
R6091:Ints2 UTSW 11 86,127,429 (GRCm39) missense probably damaging 0.96
R6209:Ints2 UTSW 11 86,115,884 (GRCm39) missense probably damaging 1.00
R6567:Ints2 UTSW 11 86,117,487 (GRCm39) missense probably benign 0.42
R6764:Ints2 UTSW 11 86,103,605 (GRCm39) missense probably benign 0.00
R7033:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R7132:Ints2 UTSW 11 86,108,580 (GRCm39) missense probably benign 0.26
R7337:Ints2 UTSW 11 86,108,668 (GRCm39) missense probably benign 0.00
R7410:Ints2 UTSW 11 86,124,052 (GRCm39) missense probably benign 0.02
R7483:Ints2 UTSW 11 86,106,444 (GRCm39) missense probably damaging 1.00
R7804:Ints2 UTSW 11 86,103,489 (GRCm39) missense possibly damaging 0.92
R7845:Ints2 UTSW 11 86,129,089 (GRCm39) missense possibly damaging 0.93
R7875:Ints2 UTSW 11 86,103,888 (GRCm39) missense probably damaging 0.99
R7918:Ints2 UTSW 11 86,113,043 (GRCm39) missense probably damaging 1.00
R7922:Ints2 UTSW 11 86,135,453 (GRCm39) missense probably benign 0.29
R8058:Ints2 UTSW 11 86,146,179 (GRCm39) missense probably benign 0.05
R8134:Ints2 UTSW 11 86,103,486 (GRCm39) missense probably damaging 1.00
R8189:Ints2 UTSW 11 86,106,396 (GRCm39) missense probably damaging 1.00
R8295:Ints2 UTSW 11 86,115,914 (GRCm39) missense probably damaging 0.97
R8348:Ints2 UTSW 11 86,146,249 (GRCm39) missense probably benign
R8448:Ints2 UTSW 11 86,146,249 (GRCm39) missense probably benign
R8784:Ints2 UTSW 11 86,115,941 (GRCm39) nonsense probably null
R8784:Ints2 UTSW 11 86,112,963 (GRCm39) missense probably damaging 1.00
R8942:Ints2 UTSW 11 86,103,720 (GRCm39) missense probably benign 0.00
R9037:Ints2 UTSW 11 86,106,530 (GRCm39) missense probably benign
R9154:Ints2 UTSW 11 86,125,524 (GRCm39) missense probably damaging 1.00
R9397:Ints2 UTSW 11 86,135,311 (GRCm39) missense probably benign 0.01
R9412:Ints2 UTSW 11 86,117,589 (GRCm39) missense probably damaging 0.99
R9472:Ints2 UTSW 11 86,133,824 (GRCm39) missense
R9476:Ints2 UTSW 11 86,135,335 (GRCm39) missense probably benign
R9510:Ints2 UTSW 11 86,135,335 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGCTGCCTATTCACTGGAC -3'
(R):5'- CCCTCATCTGAAATTGAGGAGAG -3'

Sequencing Primer
(F):5'- ATTCACTGGACTTCCATGGATG -3'
(R):5'- TGTCATGCATGCCCTTCAAGG -3'
Posted On 2019-10-17