Mutagenetix > Incidental Mutations

Incidental Mutation 'R7503:Ints2'

581630

Institutional Source

Beutler Lab

Gene Symbol

Ints2

Ensembl Gene

ENSMUSG00000018068

Gene Name

integrator complex subunit 2

Synonyms

2810417D08Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7503 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

86210681-86257575 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86232055 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 633 (T633A)

Ref Sequence

ENSEMBL: ENSMUSP00000018212 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]

Predicted Effect

probably benign
Transcript: ENSMUST00000018212
AA Change: T633A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: T633A

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1131	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108039
AA Change: T633A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: T633A

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1132	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000134828

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730559C18Rik	T	C	1: 136,215,937	D587G	possibly damaging	Het
A230072I06Rik	G	A	8: 12,279,554	G3D	unknown	Het
Aif1	A	T	17: 35,171,573	I67N	probably damaging	Het
Akap11	T	C	14: 78,512,001	D982G		Het
Anpep	A	G	7: 79,826,637	L827P	probably damaging	Het
Arhgef5	A	T	6: 43,273,999	K561N	probably benign	Het
Arsj	T	C	3: 126,364,844	F24S	probably benign	Het
Bard1	T	C	1: 71,030,836	D661G	probably damaging	Het
Cc2d2b	A	G	19: 40,794,612	I618V	unknown	Het
Cfap54	T	A	10: 92,887,436		probably null	Het
Cfhr2	T	A	1: 139,831,214	I33F	probably damaging	Het
Dsc1	G	A	18: 20,085,865	H827Y	probably damaging	Het
Eif3i	C	T	4: 129,600,414	D31N	probably damaging	Het
Eno1b	A	T	18: 48,046,811	T19S	probably damaging	Het
Eva1a	G	A	6: 82,071,229	W29*	probably null	Het
Evc	T	C	5: 37,300,767	K803R	unknown	Het
F5	T	A	1: 164,192,210	N751K	probably damaging	Het
Fam120a	A	T	13: 48,949,247	N177K	probably benign	Het
Farp2	T	G	1: 93,567,497	I164R	probably benign	Het
Gm20379	C	T	13: 92,306,057	P26L		Het
Gm4778	A	T	3: 94,266,473	M259L	probably benign	Het
Hmgcs2	T	C	3: 98,302,624	S433P	probably damaging	Het
Invs	C	T	4: 48,396,347	T340M	probably damaging	Het
Mef2c	A	C	13: 83,662,504	D391A	possibly damaging	Het
Msh4	A	C	3: 153,867,750	S756A	probably damaging	Het
Mylk3	T	C	8: 85,353,589	T490A	probably benign	Het
Myo1b	A	T	1: 51,776,602		probably null	Het
Nsmce1	A	G	7: 125,471,934	S107P	probably benign	Het
Olfr1173	T	C	2: 88,274,695	Y118C	probably damaging	Het
Olfr628	T	A	7: 103,732,267	S114T	probably damaging	Het
Pcdhb21	G	A	18: 37,514,975	D386N	probably benign	Het
Pcdhb22	T	G	18: 37,519,102	L208V	probably benign	Het
Pigu	C	T	2: 155,331,144		probably null	Het
Plcz1	T	A	6: 139,990,748	E585V	probably damaging	Het
Pnpla7	C	A	2: 24,983,532	C183*	probably null	Het
Pomgnt1	T	C	4: 116,152,752	V133A	possibly damaging	Het
Prl3d3	A	G	13: 27,161,113	Y156C	probably benign	Het
Prpf39	A	G	12: 65,053,393	D280G	probably benign	Het
Recql5	C	A	11: 115,895,055	A631S	probably benign	Het
Runx3	C	A	4: 135,155,368	N138K	probably damaging	Het
Scaper	T	C	9: 55,807,754	D750G	probably damaging	Het
Slc16a3	T	C	11: 120,957,027	L347P	probably damaging	Het
Slc25a1	G	T	16: 17,926,439	Y209*	probably null	Het
Smad2	A	G	18: 76,286,885	S88G	probably benign	Het
Sorcs1	A	G	19: 50,153,052	C1125R	probably benign	Het
Spata21	T	A	4: 141,095,303	I140N	probably benign	Het
Speer3	A	T	5: 13,793,334	D85V	probably benign	Het
Stra6	A	G	9: 58,151,245	N463S	possibly damaging	Het
Tmem14a	T	G	1: 21,229,399		probably null	Het
Tsc1	T	A	2: 28,687,076	L1130Q	possibly damaging	Het
Ttn	T	C	2: 76,781,057	D17377G	possibly damaging	Het
Utf1	A	G	7: 139,944,133	D87G	probably damaging	Het
Vmn2r6	G	A	3: 64,539,951	Q565*	probably null	Het
Vmn2r63	A	T	7: 42,933,590	M67K	probably benign	Het
Vmn2r90	T	C	17: 17,713,248	Y357H	not run	Het
Vmn2r97	A	G	17: 18,928,208	T122A	probably benign	Het
Wdhd1	T	C	14: 47,250,791	E753G	probably benign	Het
Wdr11	A	G	7: 129,603,110	N213S	probably benign	Het
Wdr66	G	T	5: 123,297,458	E994*	probably null	Het
Xdh	A	C	17: 73,926,210	D207E	probably damaging	Het
Zfp281	T	A	1: 136,626,940	I552N	possibly damaging	Het
Zzef1	T	A	11: 72,826,067	I361K	probably damaging	Het

Other mutations in Ints2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00807:Ints2	APN	11	86233135	missense	probably damaging	1.00
IGL02490:Ints2	APN	11	86233183	missense	possibly damaging	0.93
IGL02612:Ints2	APN	11	86215578	missense	probably damaging	1.00
IGL03396:Ints2	APN	11	86213062	missense	probably damaging	0.99
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0355:Ints2	UTSW	11	86234749	missense	probably benign	0.00
R0389:Ints2	UTSW	11	86248851	missense	probably damaging	1.00
R0631:Ints2	UTSW	11	86233196	missense	probably benign	0.02
R0944:Ints2	UTSW	11	86244463	missense	possibly damaging	0.85
R1268:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1269:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1270:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1396:Ints2	UTSW	11	86249248	missense	probably damaging	0.98
R1474:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1503:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1840:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1987:Ints2	UTSW	11	86217800	missense	probably benign	0.03
R1990:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R1991:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R3694:Ints2	UTSW	11	86243001	missense	probably benign	0.41
R4056:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4057:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4569:Ints2	UTSW	11	86256198	missense	probably damaging	1.00
R4585:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4586:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4806:Ints2	UTSW	11	86256209	missense	probably benign	0.10
R4929:Ints2	UTSW	11	86212653	missense	possibly damaging	0.56
R5031:Ints2	UTSW	11	86256200	missense	probably damaging	1.00
R5064:Ints2	UTSW	11	86249274	missense	probably damaging	1.00
R5270:Ints2	UTSW	11	86215795	missense	probably damaging	1.00
R5621:Ints2	UTSW	11	86242947	missense	probably benign	0.32
R5875:Ints2	UTSW	11	86238312	missense	probably benign	0.04
R5908:Ints2	UTSW	11	86215545	critical splice donor site	probably null
R5914:Ints2	UTSW	11	86222174	missense	probably benign	0.03
R5941:Ints2	UTSW	11	86250972	missense	probably benign	0.01
R5975:Ints2	UTSW	11	86226748	missense	possibly damaging	0.72
R6003:Ints2	UTSW	11	86238468	missense	probably damaging	1.00
R6091:Ints2	UTSW	11	86236603	missense	probably damaging	0.96
R6209:Ints2	UTSW	11	86225058	missense	probably damaging	1.00
R6567:Ints2	UTSW	11	86226661	missense	probably benign	0.42
R6764:Ints2	UTSW	11	86212779	missense	probably benign	0.00
R7033:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R7132:Ints2	UTSW	11	86217754	missense	probably benign	0.26
R7337:Ints2	UTSW	11	86217842	missense	probably benign	0.00
R7410:Ints2	UTSW	11	86233226	missense	probably benign	0.02
R7483:Ints2	UTSW	11	86215618	missense	probably damaging	1.00
R7804:Ints2	UTSW	11	86212663	missense	possibly damaging	0.92
R7845:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7875:Ints2	UTSW	11	86213062	missense	probably damaging	0.99
R7918:Ints2	UTSW	11	86222217	missense	probably damaging	1.00
R7922:Ints2	UTSW	11	86244627	missense	probably benign	0.29
R8058:Ints2	UTSW	11	86255353	missense	probably benign	0.05
R8134:Ints2	UTSW	11	86212660	missense	probably damaging	1.00
R8189:Ints2	UTSW	11	86215570	missense	probably damaging	1.00
R8295:Ints2	UTSW	11	86225088	missense	probably damaging	0.97
R8348:Ints2	UTSW	11	86255423	missense	probably benign
R8448:Ints2	UTSW	11	86255423	missense	probably benign
R8784:Ints2	UTSW	11	86222137	missense	probably damaging	1.00
R8784:Ints2	UTSW	11	86225115	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACTGCTGCCTATTCACTGGAC -3'
(R):5'- CCCTCATCTGAAATTGAGGAGAG -3'

Sequencing Primer
(F):5'- ATTCACTGGACTTCCATGGATG -3'
(R):5'- TGTCATGCATGCCCTTCAAGG -3'

Posted On

2019-10-17