Incidental Mutation 'R7503:Recql5'
ID581631
Institutional Source Beutler Lab
Gene Symbol Recql5
Ensembl Gene ENSMUSG00000020752
Gene NameRecQ protein-like 5
SynonymsRecq5b, Recql5b
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.492) question?
Stock #R7503 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location115892595-115933477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 115895055 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 631 (A631S)
Ref Sequence ENSEMBL: ENSMUSP00000021097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021097] [ENSMUST00000093911] [ENSMUST00000131578] [ENSMUST00000140174] [ENSMUST00000152171] [ENSMUST00000167507] [ENSMUST00000222123]
Predicted Effect probably benign
Transcript: ENSMUST00000021097
AA Change: A631S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021097
Gene: ENSMUSG00000020752
AA Change: A631S

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
HELICc 274 355 8.68e-22 SMART
Pfam:RecQ_Zn_bind 366 436 1.8e-12 PFAM
low complexity region 472 499 N/A INTRINSIC
PDB:4BK0|B 516 621 2e-51 PDB
Pfam:RecQ5 626 818 3.1e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093911
SMART Domains Protein: ENSMUSP00000091439
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
MYSc 1 640 2.4e-134 SMART
IQ 660 682 1.03e1 SMART
Pfam:MyTH4 837 945 2.1e-23 PFAM
low complexity region 1050 1068 N/A INTRINSIC
low complexity region 1136 1170 N/A INTRINSIC
low complexity region 1207 1246 N/A INTRINSIC
low complexity region 1302 1327 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
low complexity region 1489 1509 N/A INTRINSIC
SH3 1735 1792 1.15e-7 SMART
Pfam:MyTH4 1928 2029 8.3e-25 PFAM
B41 2032 2235 6.99e-4 SMART
low complexity region 2243 2253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131578
SMART Domains Protein: ENSMUSP00000136178
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
HELICc 1 82 8.68e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140174
SMART Domains Protein: ENSMUSP00000136506
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152171
SMART Domains Protein: ENSMUSP00000139148
Gene: ENSMUSG00000048442

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167507
SMART Domains Protein: ENSMUSP00000129226
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
Pfam:MyTH4 100 205 3.1e-24 PFAM
B41 207 410 6.99e-4 SMART
low complexity region 418 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222123
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a helicase that is important for genome stability. The encoded protein also prevents aberrant homologous recombination by displacing RAD51 from ssDNA. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene express elevated levels of sister chromatid exchange due to a failure to suppress crossovers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T C 1: 136,215,937 D587G possibly damaging Het
A230072I06Rik G A 8: 12,279,554 G3D unknown Het
Aif1 A T 17: 35,171,573 I67N probably damaging Het
Akap11 T C 14: 78,512,001 D982G Het
Anpep A G 7: 79,826,637 L827P probably damaging Het
Arhgef5 A T 6: 43,273,999 K561N probably benign Het
Arsj T C 3: 126,364,844 F24S probably benign Het
Bard1 T C 1: 71,030,836 D661G probably damaging Het
Cc2d2b A G 19: 40,794,612 I618V unknown Het
Cfap54 T A 10: 92,887,436 probably null Het
Cfhr2 T A 1: 139,831,214 I33F probably damaging Het
Dsc1 G A 18: 20,085,865 H827Y probably damaging Het
Eif3i C T 4: 129,600,414 D31N probably damaging Het
Eno1b A T 18: 48,046,811 T19S probably damaging Het
Eva1a G A 6: 82,071,229 W29* probably null Het
Evc T C 5: 37,300,767 K803R unknown Het
F5 T A 1: 164,192,210 N751K probably damaging Het
Fam120a A T 13: 48,949,247 N177K probably benign Het
Farp2 T G 1: 93,567,497 I164R probably benign Het
Gm20379 C T 13: 92,306,057 P26L Het
Gm4778 A T 3: 94,266,473 M259L probably benign Het
Hmgcs2 T C 3: 98,302,624 S433P probably damaging Het
Ints2 T C 11: 86,232,055 T633A probably benign Het
Invs C T 4: 48,396,347 T340M probably damaging Het
Mef2c A C 13: 83,662,504 D391A possibly damaging Het
Msh4 A C 3: 153,867,750 S756A probably damaging Het
Mylk3 T C 8: 85,353,589 T490A probably benign Het
Myo1b A T 1: 51,776,602 probably null Het
Nsmce1 A G 7: 125,471,934 S107P probably benign Het
Olfr1173 T C 2: 88,274,695 Y118C probably damaging Het
Olfr628 T A 7: 103,732,267 S114T probably damaging Het
Pcdhb21 G A 18: 37,514,975 D386N probably benign Het
Pcdhb22 T G 18: 37,519,102 L208V probably benign Het
Pigu C T 2: 155,331,144 probably null Het
Plcz1 T A 6: 139,990,748 E585V probably damaging Het
Pnpla7 C A 2: 24,983,532 C183* probably null Het
Pomgnt1 T C 4: 116,152,752 V133A possibly damaging Het
Prl3d3 A G 13: 27,161,113 Y156C probably benign Het
Prpf39 A G 12: 65,053,393 D280G probably benign Het
Runx3 C A 4: 135,155,368 N138K probably damaging Het
Scaper T C 9: 55,807,754 D750G probably damaging Het
Slc16a3 T C 11: 120,957,027 L347P probably damaging Het
Slc25a1 G T 16: 17,926,439 Y209* probably null Het
Smad2 A G 18: 76,286,885 S88G probably benign Het
Sorcs1 A G 19: 50,153,052 C1125R probably benign Het
Spata21 T A 4: 141,095,303 I140N probably benign Het
Speer3 A T 5: 13,793,334 D85V probably benign Het
Stra6 A G 9: 58,151,245 N463S possibly damaging Het
Tmem14a T G 1: 21,229,399 probably null Het
Tsc1 T A 2: 28,687,076 L1130Q possibly damaging Het
Ttn T C 2: 76,781,057 D17377G possibly damaging Het
Utf1 A G 7: 139,944,133 D87G probably damaging Het
Vmn2r6 G A 3: 64,539,951 Q565* probably null Het
Vmn2r63 A T 7: 42,933,590 M67K probably benign Het
Vmn2r90 T C 17: 17,713,248 Y357H not run Het
Vmn2r97 A G 17: 18,928,208 T122A probably benign Het
Wdhd1 T C 14: 47,250,791 E753G probably benign Het
Wdr11 A G 7: 129,603,110 N213S probably benign Het
Wdr66 G T 5: 123,297,458 E994* probably null Het
Xdh A C 17: 73,926,210 D207E probably damaging Het
Zfp281 T A 1: 136,626,940 I552N possibly damaging Het
Zzef1 T A 11: 72,826,067 I361K probably damaging Het
Other mutations in Recql5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Recql5 APN 11 115897181 missense probably benign 0.04
IGL01589:Recql5 APN 11 115894669 missense probably damaging 1.00
IGL02040:Recql5 APN 11 115932797 missense possibly damaging 0.89
IGL02131:Recql5 APN 11 115923242 missense probably benign 0.01
IGL02198:Recql5 APN 11 115894673 missense probably benign 0.00
IGL02236:Recql5 APN 11 115894030 missense probably benign 0.01
IGL02501:Recql5 APN 11 115895091 missense probably benign 0.26
IGL02980:Recql5 APN 11 115893944 splice site probably null
IGL03028:Recql5 APN 11 115894431 missense possibly damaging 0.94
PIT4581001:Recql5 UTSW 11 115932856 missense possibly damaging 0.53
R0152:Recql5 UTSW 11 115894673 missense probably benign
R0269:Recql5 UTSW 11 115928224 missense possibly damaging 0.91
R0317:Recql5 UTSW 11 115894673 missense probably benign
R0511:Recql5 UTSW 11 115928383 missense probably benign 0.00
R0786:Recql5 UTSW 11 115895802 missense probably benign
R0975:Recql5 UTSW 11 115923256 missense probably damaging 1.00
R1170:Recql5 UTSW 11 115897234 missense probably damaging 0.98
R1208:Recql5 UTSW 11 115893156 missense probably damaging 0.98
R1208:Recql5 UTSW 11 115893156 missense probably damaging 0.98
R1807:Recql5 UTSW 11 115895115 missense possibly damaging 0.63
R1872:Recql5 UTSW 11 115923309 missense probably benign 0.15
R1878:Recql5 UTSW 11 115895101 missense probably benign 0.00
R1935:Recql5 UTSW 11 115897191 missense probably benign 0.00
R1936:Recql5 UTSW 11 115897191 missense probably benign 0.00
R1945:Recql5 UTSW 11 115928297 nonsense probably null
R2011:Recql5 UTSW 11 115897097 missense probably benign 0.20
R2012:Recql5 UTSW 11 115897097 missense probably benign 0.20
R2023:Recql5 UTSW 11 115893640 missense probably benign
R2183:Recql5 UTSW 11 115896787 missense probably benign 0.00
R3881:Recql5 UTSW 11 115893954 missense probably benign
R3881:Recql5 UTSW 11 115893955 missense probably benign 0.00
R4093:Recql5 UTSW 11 115904888 missense probably benign 0.05
R4857:Recql5 UTSW 11 115928212 missense probably damaging 1.00
R5245:Recql5 UTSW 11 115893559 missense probably damaging 1.00
R5323:Recql5 UTSW 11 115927389 missense probably damaging 1.00
R5796:Recql5 UTSW 11 115927865 intron probably benign
R6160:Recql5 UTSW 11 115932787 critical splice donor site probably null
R6229:Recql5 UTSW 11 115930714 missense probably damaging 0.96
R6824:Recql5 UTSW 11 115923212 missense possibly damaging 0.83
R7013:Recql5 UTSW 11 115894576 missense probably benign 0.02
R7043:Recql5 UTSW 11 115930676 critical splice donor site probably null
R7135:Recql5 UTSW 11 115930672 splice site probably null
R7354:Recql5 UTSW 11 115928201 missense probably damaging 1.00
R7373:Recql5 UTSW 11 115928372 missense possibly damaging 0.92
R7574:Recql5 UTSW 11 115928422 missense probably benign
R7597:Recql5 UTSW 11 115928381 missense probably benign 0.03
R7658:Recql5 UTSW 11 115923276 missense probably damaging 1.00
R8025:Recql5 UTSW 11 115928112 missense probably damaging 1.00
R8038:Recql5 UTSW 11 115927352 missense possibly damaging 0.90
R8316:Recql5 UTSW 11 115894035 missense possibly damaging 0.46
X0026:Recql5 UTSW 11 115923261 missense probably damaging 1.00
X0028:Recql5 UTSW 11 115894606 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAGCACCGCTACTCAATG -3'
(R):5'- AGCTCATCTGCTGACTGGAG -3'

Sequencing Primer
(F):5'- AATGACCCTTTCTGACATCTGGGAG -3'
(R):5'- ACTGGAGGTGTGGCCATC -3'
Posted On2019-10-17