Incidental Mutation 'R7503:Slc16a3'
ID581632
Institutional Source Beutler Lab
Gene Symbol Slc16a3
Ensembl Gene ENSMUSG00000025161
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 3
SynonymsMCT4, monocarboxylate transporter 4, MCT3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7503 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location120948480-120960868 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120957027 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 347 (L347P)
Ref Sequence ENSEMBL: ENSMUSP00000068854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018274] [ENSMUST00000070575] [ENSMUST00000070653] [ENSMUST00000100130] [ENSMUST00000129473] [ENSMUST00000133029] [ENSMUST00000154187] [ENSMUST00000168579]
Predicted Effect probably benign
Transcript: ENSMUST00000018274
SMART Domains Protein: ENSMUSP00000018274
Gene: ENSMUSG00000025162

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 273 3.7e-18 PFAM
Pfam:Pkinase 9 277 1.8e-28 PFAM
low complexity region 299 314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070575
SMART Domains Protein: ENSMUSP00000070721
Gene: ENSMUSG00000025162

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 273 1.6e-18 PFAM
Pfam:Pkinase 9 280 2.8e-41 PFAM
low complexity region 299 314 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000070653
AA Change: L347P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068854
Gene: ENSMUSG00000025161
AA Change: L347P

DomainStartEndE-ValueType
Pfam:MFS_1 25 375 6.3e-32 PFAM
transmembrane domain 390 412 N/A INTRINSIC
low complexity region 420 432 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100130
AA Change: L347P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097706
Gene: ENSMUSG00000025161
AA Change: L347P

DomainStartEndE-ValueType
Pfam:MFS_1 25 375 6.3e-32 PFAM
transmembrane domain 390 412 N/A INTRINSIC
low complexity region 420 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129473
SMART Domains Protein: ENSMUSP00000117275
Gene: ENSMUSG00000025161

DomainStartEndE-ValueType
Pfam:MFS_1 25 290 5.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133029
Predicted Effect probably benign
Transcript: ENSMUST00000154187
SMART Domains Protein: ENSMUSP00000122784
Gene: ENSMUSG00000025161

DomainStartEndE-ValueType
Pfam:MFS_1 25 253 3.7e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168579
AA Change: L347P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125846
Gene: ENSMUSG00000025161
AA Change: L347P

DomainStartEndE-ValueType
Pfam:MFS_1 25 375 8.3e-32 PFAM
transmembrane domain 390 412 N/A INTRINSIC
low complexity region 420 432 N/A INTRINSIC
Meta Mutation Damage Score 0.9524 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Lactic acid and pyruvate transport across plasma membranes is catalyzed by members of the proton-linked monocarboxylate transporter (MCT) family, which has been designated solute carrier family-16. Each MCT appears to have slightly different substrate and inhibitor specificities and transport kinetics, which are related to the metabolic requirements of the tissues in which it is found. The MCTs, which include MCT1 (SLC16A1; MIM 600682) and MCT2 (SLC16A7; MIM 603654), are characterized by 12 predicted transmembrane domains (Price et al., 1998 [PubMed 9425115]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T C 1: 136,215,937 D587G possibly damaging Het
A230072I06Rik G A 8: 12,279,554 G3D unknown Het
Aif1 A T 17: 35,171,573 I67N probably damaging Het
Akap11 T C 14: 78,512,001 D982G Het
Anpep A G 7: 79,826,637 L827P probably damaging Het
Arhgef5 A T 6: 43,273,999 K561N probably benign Het
Arsj T C 3: 126,364,844 F24S probably benign Het
Bard1 T C 1: 71,030,836 D661G probably damaging Het
Cc2d2b A G 19: 40,794,612 I618V unknown Het
Cfap54 T A 10: 92,887,436 probably null Het
Cfhr2 T A 1: 139,831,214 I33F probably damaging Het
Dsc1 G A 18: 20,085,865 H827Y probably damaging Het
Eif3i C T 4: 129,600,414 D31N probably damaging Het
Eno1b A T 18: 48,046,811 T19S probably damaging Het
Eva1a G A 6: 82,071,229 W29* probably null Het
Evc T C 5: 37,300,767 K803R unknown Het
F5 T A 1: 164,192,210 N751K probably damaging Het
Fam120a A T 13: 48,949,247 N177K probably benign Het
Farp2 T G 1: 93,567,497 I164R probably benign Het
Gm20379 C T 13: 92,306,057 P26L Het
Gm4778 A T 3: 94,266,473 M259L probably benign Het
Hmgcs2 T C 3: 98,302,624 S433P probably damaging Het
Ints2 T C 11: 86,232,055 T633A probably benign Het
Invs C T 4: 48,396,347 T340M probably damaging Het
Mef2c A C 13: 83,662,504 D391A possibly damaging Het
Msh4 A C 3: 153,867,750 S756A probably damaging Het
Mylk3 T C 8: 85,353,589 T490A probably benign Het
Myo1b A T 1: 51,776,602 probably null Het
Nsmce1 A G 7: 125,471,934 S107P probably benign Het
Olfr1173 T C 2: 88,274,695 Y118C probably damaging Het
Olfr628 T A 7: 103,732,267 S114T probably damaging Het
Pcdhb21 G A 18: 37,514,975 D386N probably benign Het
Pcdhb22 T G 18: 37,519,102 L208V probably benign Het
Pigu C T 2: 155,331,144 probably null Het
Plcz1 T A 6: 139,990,748 E585V probably damaging Het
Pnpla7 C A 2: 24,983,532 C183* probably null Het
Pomgnt1 T C 4: 116,152,752 V133A possibly damaging Het
Prl3d3 A G 13: 27,161,113 Y156C probably benign Het
Prpf39 A G 12: 65,053,393 D280G probably benign Het
Recql5 C A 11: 115,895,055 A631S probably benign Het
Runx3 C A 4: 135,155,368 N138K probably damaging Het
Scaper T C 9: 55,807,754 D750G probably damaging Het
Slc25a1 G T 16: 17,926,439 Y209* probably null Het
Smad2 A G 18: 76,286,885 S88G probably benign Het
Sorcs1 A G 19: 50,153,052 C1125R probably benign Het
Spata21 T A 4: 141,095,303 I140N probably benign Het
Speer3 A T 5: 13,793,334 D85V probably benign Het
Stra6 A G 9: 58,151,245 N463S possibly damaging Het
Tmem14a T G 1: 21,229,399 probably null Het
Tsc1 T A 2: 28,687,076 L1130Q possibly damaging Het
Ttn T C 2: 76,781,057 D17377G possibly damaging Het
Utf1 A G 7: 139,944,133 D87G probably damaging Het
Vmn2r6 G A 3: 64,539,951 Q565* probably null Het
Vmn2r63 A T 7: 42,933,590 M67K probably benign Het
Vmn2r90 T C 17: 17,713,248 Y357H not run Het
Vmn2r97 A G 17: 18,928,208 T122A probably benign Het
Wdhd1 T C 14: 47,250,791 E753G probably benign Het
Wdr11 A G 7: 129,603,110 N213S probably benign Het
Wdr66 G T 5: 123,297,458 E994* probably null Het
Xdh A C 17: 73,926,210 D207E probably damaging Het
Zfp281 T A 1: 136,626,940 I552N possibly damaging Het
Zzef1 T A 11: 72,826,067 I361K probably damaging Het
Other mutations in Slc16a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01662:Slc16a3 APN 11 120956706 nonsense probably null
IGL01943:Slc16a3 APN 11 120956883 unclassified probably null
IGL01967:Slc16a3 APN 11 120957038 missense probably damaging 0.99
IGL01970:Slc16a3 APN 11 120957038 missense probably damaging 0.99
IGL02189:Slc16a3 APN 11 120956771 missense probably benign 0.01
PIT4131001:Slc16a3 UTSW 11 120955346 missense probably damaging 1.00
R0010:Slc16a3 UTSW 11 120956705 missense probably benign 0.00
R0466:Slc16a3 UTSW 11 120958052 missense possibly damaging 0.77
R3967:Slc16a3 UTSW 11 120955425 missense possibly damaging 0.63
R4471:Slc16a3 UTSW 11 120955948 splice site probably benign
R4913:Slc16a3 UTSW 11 120957968 missense probably benign
R5826:Slc16a3 UTSW 11 120956930 missense probably benign
R5863:Slc16a3 UTSW 11 120957953 missense probably benign
R6019:Slc16a3 UTSW 11 120957105 unclassified probably null
X0022:Slc16a3 UTSW 11 120956702 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GGTTTCATAACAGGCCTCAAGAAG -3'
(R):5'- TTAGCTGTTGACACCTGCTGG -3'

Sequencing Primer
(F):5'- AAGAAGGTGCGGCCCTACTC -3'
(R):5'- AGTCTCCTAACGCCGGGTATG -3'
Posted On2019-10-17