Incidental Mutation 'R7503:Prpf39'
ID581633
Institutional Source Beutler Lab
Gene Symbol Prpf39
Ensembl Gene ENSMUSG00000035597
Gene Namepre-mRNA processing factor 39
SynonymsSrcs1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R7503 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location65036333-65063386 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65053393 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 280 (D280G)
Ref Sequence ENSEMBL: ENSMUSP00000112953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120580] [ENSMUST00000129956] [ENSMUST00000223315]
Predicted Effect probably benign
Transcript: ENSMUST00000120580
AA Change: D280G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112953
Gene: ENSMUSG00000035597
AA Change: D280G

DomainStartEndE-ValueType
HAT 107 139 3.71e-2 SMART
HAT 141 173 4.39e-4 SMART
HAT 181 216 2.07e0 SMART
HAT 218 251 1.36e2 SMART
low complexity region 277 290 N/A INTRINSIC
Blast:HAT 323 363 6e-18 BLAST
HAT 365 397 3.2e-6 SMART
HAT 398 431 3.21e1 SMART
HAT 505 537 3.63e1 SMART
low complexity region 645 664 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129956
SMART Domains Protein: ENSMUSP00000114713
Gene: ENSMUSG00000035597

DomainStartEndE-ValueType
Blast:HAT 107 139 7e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000223315
AA Change: D161G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T C 1: 136,215,937 D587G possibly damaging Het
A230072I06Rik G A 8: 12,279,554 G3D unknown Het
Aif1 A T 17: 35,171,573 I67N probably damaging Het
Akap11 T C 14: 78,512,001 D982G Het
Anpep A G 7: 79,826,637 L827P probably damaging Het
Arhgef5 A T 6: 43,273,999 K561N probably benign Het
Arsj T C 3: 126,364,844 F24S probably benign Het
Bard1 T C 1: 71,030,836 D661G probably damaging Het
Cc2d2b A G 19: 40,794,612 I618V unknown Het
Cfap54 T A 10: 92,887,436 probably null Het
Cfhr2 T A 1: 139,831,214 I33F probably damaging Het
Dsc1 G A 18: 20,085,865 H827Y probably damaging Het
Eif3i C T 4: 129,600,414 D31N probably damaging Het
Eno1b A T 18: 48,046,811 T19S probably damaging Het
Eva1a G A 6: 82,071,229 W29* probably null Het
Evc T C 5: 37,300,767 K803R unknown Het
F5 T A 1: 164,192,210 N751K probably damaging Het
Fam120a A T 13: 48,949,247 N177K probably benign Het
Farp2 T G 1: 93,567,497 I164R probably benign Het
Gm20379 C T 13: 92,306,057 P26L Het
Gm4778 A T 3: 94,266,473 M259L probably benign Het
Hmgcs2 T C 3: 98,302,624 S433P probably damaging Het
Ints2 T C 11: 86,232,055 T633A probably benign Het
Invs C T 4: 48,396,347 T340M probably damaging Het
Mef2c A C 13: 83,662,504 D391A possibly damaging Het
Msh4 A C 3: 153,867,750 S756A probably damaging Het
Mylk3 T C 8: 85,353,589 T490A probably benign Het
Myo1b A T 1: 51,776,602 probably null Het
Nsmce1 A G 7: 125,471,934 S107P probably benign Het
Olfr1173 T C 2: 88,274,695 Y118C probably damaging Het
Olfr628 T A 7: 103,732,267 S114T probably damaging Het
Pcdhb21 G A 18: 37,514,975 D386N probably benign Het
Pcdhb22 T G 18: 37,519,102 L208V probably benign Het
Pigu C T 2: 155,331,144 probably null Het
Plcz1 T A 6: 139,990,748 E585V probably damaging Het
Pnpla7 C A 2: 24,983,532 C183* probably null Het
Pomgnt1 T C 4: 116,152,752 V133A possibly damaging Het
Prl3d3 A G 13: 27,161,113 Y156C probably benign Het
Recql5 C A 11: 115,895,055 A631S probably benign Het
Runx3 C A 4: 135,155,368 N138K probably damaging Het
Scaper T C 9: 55,807,754 D750G probably damaging Het
Slc16a3 T C 11: 120,957,027 L347P probably damaging Het
Slc25a1 G T 16: 17,926,439 Y209* probably null Het
Smad2 A G 18: 76,286,885 S88G probably benign Het
Sorcs1 A G 19: 50,153,052 C1125R probably benign Het
Spata21 T A 4: 141,095,303 I140N probably benign Het
Speer3 A T 5: 13,793,334 D85V probably benign Het
Stra6 A G 9: 58,151,245 N463S possibly damaging Het
Tmem14a T G 1: 21,229,399 probably null Het
Tsc1 T A 2: 28,687,076 L1130Q possibly damaging Het
Ttn T C 2: 76,781,057 D17377G possibly damaging Het
Utf1 A G 7: 139,944,133 D87G probably damaging Het
Vmn2r6 G A 3: 64,539,951 Q565* probably null Het
Vmn2r63 A T 7: 42,933,590 M67K probably benign Het
Vmn2r90 T C 17: 17,713,248 Y357H not run Het
Vmn2r97 A G 17: 18,928,208 T122A probably benign Het
Wdhd1 T C 14: 47,250,791 E753G probably benign Het
Wdr11 A G 7: 129,603,110 N213S probably benign Het
Wdr66 G T 5: 123,297,458 E994* probably null Het
Xdh A C 17: 73,926,210 D207E probably damaging Het
Zfp281 T A 1: 136,626,940 I552N possibly damaging Het
Zzef1 T A 11: 72,826,067 I361K probably damaging Het
Other mutations in Prpf39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Prpf39 APN 12 65043263 missense probably damaging 0.99
IGL01025:Prpf39 APN 12 65042481 unclassified probably benign
IGL01323:Prpf39 APN 12 65042724 missense possibly damaging 0.70
IGL02346:Prpf39 APN 12 65057736 missense probably benign 0.02
IGL02966:Prpf39 APN 12 65042779 missense probably benign 0.45
IGL03189:Prpf39 APN 12 65043302 nonsense probably null
IGL03357:Prpf39 APN 12 65061437 unclassified probably benign
R0103:Prpf39 UTSW 12 65055283 missense possibly damaging 0.56
R0103:Prpf39 UTSW 12 65055283 missense possibly damaging 0.56
R0328:Prpf39 UTSW 12 65043371 splice site probably benign
R0549:Prpf39 UTSW 12 65056256 missense probably benign 0.05
R0840:Prpf39 UTSW 12 65048206 missense probably benign 0.21
R1248:Prpf39 UTSW 12 65053966 splice site probably benign
R1322:Prpf39 UTSW 12 65042662 missense possibly damaging 0.48
R1481:Prpf39 UTSW 12 65053314 missense probably damaging 1.00
R2209:Prpf39 UTSW 12 65057915 critical splice donor site probably null
R2232:Prpf39 UTSW 12 65044012 nonsense probably null
R2507:Prpf39 UTSW 12 65057815 missense probably benign 0.36
R2508:Prpf39 UTSW 12 65057815 missense probably benign 0.36
R2959:Prpf39 UTSW 12 65042523 missense probably damaging 1.00
R3117:Prpf39 UTSW 12 65057877 missense possibly damaging 0.79
R3118:Prpf39 UTSW 12 65057877 missense possibly damaging 0.79
R3980:Prpf39 UTSW 12 65061457 unclassified probably benign
R4407:Prpf39 UTSW 12 65056266 missense probably damaging 1.00
R4620:Prpf39 UTSW 12 65042563 missense probably benign
R4926:Prpf39 UTSW 12 65044056 missense possibly damaging 0.90
R5154:Prpf39 UTSW 12 65048277 missense probably benign 0.29
R6248:Prpf39 UTSW 12 65042754 missense probably damaging 1.00
R6334:Prpf39 UTSW 12 65042813 unclassified probably null
R6614:Prpf39 UTSW 12 65042563 missense probably benign
R6749:Prpf39 UTSW 12 65056274 missense possibly damaging 0.94
R6944:Prpf39 UTSW 12 65042680 missense probably benign 0.03
R7023:Prpf39 UTSW 12 65053300 missense possibly damaging 0.94
R7532:Prpf39 UTSW 12 65053371 missense probably benign 0.00
R7608:Prpf39 UTSW 12 65053446 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TCCACTGCAAAGACAGTGGG -3'
(R):5'- GGTGTGTCATGGTAAAACTTTCTC -3'

Sequencing Primer
(F):5'- ATATGCATAAATACTCACCAAGTGG -3'
(R):5'- GGCACACTTTATCACCATT -3'
Posted On2019-10-17