Mutagenetix > Incidental Mutation

Incidental Mutation 'R7503:Smad2'

581650

Institutional Source

Beutler Lab

Gene Symbol

Smad2

Ensembl Gene

ENSMUSG00000024563

Gene Name

SMAD family member 2

Synonyms

Smad 2, Madr2, 7120426M23Rik, Madh2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7503 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

76241580-76305731 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 76286885 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 88 (S88G)

Ref Sequence

ENSEMBL: ENSMUSP00000025453 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025453] [ENSMUST00000091831] [ENSMUST00000113930] [ENSMUST00000165084] [ENSMUST00000168423] [ENSMUST00000171256] [ENSMUST00000172198]

AlphaFold

Q62432

Predicted Effect

probably benign
Transcript: ENSMUST00000025453
AA Change: S88G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000025453
Gene: ENSMUSG00000024563
AA Change: S88G

Domain	Start	End	E-Value	Type
DWA	36	174	1e-64	SMART
Blast:DWB	230	261	2e-10	BLAST
DWB	272	443	2.25e-108	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000091831

SMART Domains

Protein: ENSMUSP00000089439
Gene: ENSMUSG00000024563

Domain	Start	End	E-Value	Type
DWA	36	144	1.68e-66	SMART
Blast:DWB	200	231	1e-10	BLAST
DWB	242	413	2.25e-108	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113930

SMART Domains

Protein: ENSMUSP00000109563
Gene: ENSMUSG00000024563

Domain	Start	End	E-Value	Type
DWA	36	144	1.68e-66	SMART
Blast:DWB	200	231	9e-11	BLAST
DWB	242	408	4.38e-88	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165084

SMART Domains

Protein: ENSMUSP00000132851
Gene: ENSMUSG00000024563

Domain	Start	End	E-Value	Type
DWA	36	144	7.85e-67	SMART
PDB:1KHX\|A	166	204	3e-19	PDB
SCOP:d1khxa_	190	204	7e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168423
AA Change: S88G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000130115
Gene: ENSMUSG00000024563
AA Change: S88G

Domain	Start	End	E-Value	Type
DWA	36	174	1e-64	SMART
Blast:DWB	230	261	2e-10	BLAST
DWB	272	443	2.25e-108	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171256
AA Change: S88G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000125883
Gene: ENSMUSG00000024563
AA Change: S88G

Domain	Start	End	E-Value	Type
DWA	36	174	1e-64	SMART
Blast:DWA	182	213	3e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000172198

SMART Domains

Protein: ENSMUSP00000129232
Gene: ENSMUSG00000024563

Domain	Start	End	E-Value	Type
Pfam:MH2	28	58	1.8e-10	PFAM

Meta Mutation Damage Score

0.0851

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signal of the transforming growth factor (TGF)-beta, and thus regulates multiple cellular processes, such as cell proliferation, apoptosis, and differentiation. This protein is recruited to the TGF-beta receptors through its interaction with the SMAD anchor for receptor activation (SARA) protein. In response to TGF-beta signal, this protein is phosphorylated by the TGF-beta receptors. The phosphorylation induces the dissociation of this protein with SARA and the association with the family member SMAD4. The association with SMAD4 is important for the translocation of this protein into the nucleus, where it binds to target promoters and forms a transcription repressor complex with other cofactors. This protein can also be phosphorylated by activin type 1 receptor kinase, and mediates the signal from the activin. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutant embryos die at day 6.5-8.5 with multiple defects, including failed gastrulation, lack of mesoderm, visceral endoderm dysfunction and failure to form anterior-posterior axis. Heterozygotes may show gastrulation defects and lack mandible or eyes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730559C18Rik	T	C	1: 136,215,937	D587G	possibly damaging	Het
A230072I06Rik	G	A	8: 12,279,554	G3D	unknown	Het
Aif1	A	T	17: 35,171,573	I67N	probably damaging	Het
Akap11	T	C	14: 78,512,001	D982G		Het
Anpep	A	G	7: 79,826,637	L827P	probably damaging	Het
Arhgef5	A	T	6: 43,273,999	K561N	probably benign	Het
Arsj	T	C	3: 126,364,844	F24S	probably benign	Het
Bard1	T	C	1: 71,030,836	D661G	probably damaging	Het
Cc2d2b	A	G	19: 40,794,612	I618V	unknown	Het
Cfap54	T	A	10: 92,887,436		probably null	Het
Cfhr2	T	A	1: 139,831,214	I33F	probably damaging	Het
Dsc1	G	A	18: 20,085,865	H827Y	probably damaging	Het
Eif3i	C	T	4: 129,600,414	D31N	probably damaging	Het
Eno1b	A	T	18: 48,046,811	T19S	probably damaging	Het
Eva1a	G	A	6: 82,071,229	W29*	probably null	Het
Evc	T	C	5: 37,300,767	K803R	unknown	Het
F5	T	A	1: 164,192,210	N751K	probably damaging	Het
Fam120a	A	T	13: 48,949,247	N177K	probably benign	Het
Farp2	T	G	1: 93,567,497	I164R	probably benign	Het
Gm20379	C	T	13: 92,306,057	P26L		Het
Gm4778	A	T	3: 94,266,473	M259L	probably benign	Het
Hmgcs2	T	C	3: 98,302,624	S433P	probably damaging	Het
Ints2	T	C	11: 86,232,055	T633A	probably benign	Het
Invs	C	T	4: 48,396,347	T340M	probably damaging	Het
Mef2c	A	C	13: 83,662,504	D391A	possibly damaging	Het
Msh4	A	C	3: 153,867,750	S756A	probably damaging	Het
Mylk3	T	C	8: 85,353,589	T490A	probably benign	Het
Myo1b	A	T	1: 51,776,602		probably null	Het
Nsmce1	A	G	7: 125,471,934	S107P	probably benign	Het
Olfr1173	T	C	2: 88,274,695	Y118C	probably damaging	Het
Olfr628	T	A	7: 103,732,267	S114T	probably damaging	Het
Pcdhb21	G	A	18: 37,514,975	D386N	probably benign	Het
Pcdhb22	T	G	18: 37,519,102	L208V	probably benign	Het
Pigu	C	T	2: 155,331,144		probably null	Het
Plcz1	T	A	6: 139,990,748	E585V	probably damaging	Het
Pnpla7	C	A	2: 24,983,532	C183*	probably null	Het
Pomgnt1	T	C	4: 116,152,752	V133A	possibly damaging	Het
Prl3d3	A	G	13: 27,161,113	Y156C	probably benign	Het
Prpf39	A	G	12: 65,053,393	D280G	probably benign	Het
Recql5	C	A	11: 115,895,055	A631S	probably benign	Het
Runx3	C	A	4: 135,155,368	N138K	probably damaging	Het
Scaper	T	C	9: 55,807,754	D750G	probably damaging	Het
Slc16a3	T	C	11: 120,957,027	L347P	probably damaging	Het
Slc25a1	G	T	16: 17,926,439	Y209*	probably null	Het
Sorcs1	A	G	19: 50,153,052	C1125R	probably benign	Het
Spata21	T	A	4: 141,095,303	I140N	probably benign	Het
Speer3	A	T	5: 13,793,334	D85V	probably benign	Het
Stra6	A	G	9: 58,151,245	N463S	possibly damaging	Het
Tmem14a	T	G	1: 21,229,399		probably null	Het
Tsc1	T	A	2: 28,687,076	L1130Q	possibly damaging	Het
Ttn	T	C	2: 76,781,057	D17377G	possibly damaging	Het
Utf1	A	G	7: 139,944,133	D87G	probably damaging	Het
Vmn2r6	G	A	3: 64,539,951	Q565*	probably null	Het
Vmn2r63	A	T	7: 42,933,590	M67K	probably benign	Het
Vmn2r90	T	C	17: 17,713,248	Y357H	not run	Het
Vmn2r97	A	G	17: 18,928,208	T122A	probably benign	Het
Wdhd1	T	C	14: 47,250,791	E753G	probably benign	Het
Wdr11	A	G	7: 129,603,110	N213S	probably benign	Het
Wdr66	G	T	5: 123,297,458	E994*	probably null	Het
Xdh	A	C	17: 73,926,210	D207E	probably damaging	Het
Zfp281	T	A	1: 136,626,940	I552N	possibly damaging	Het
Zzef1	T	A	11: 72,826,067	I361K	probably damaging	Het

Other mutations in Smad2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Smad2	APN	18	76298495	missense	possibly damaging	0.94
IGL00978:Smad2	APN	18	76299775	splice site	probably benign
IGL01295:Smad2	APN	18	76302430	missense	probably benign	0.05
IGL01887:Smad2	APN	18	76299894	missense	probably damaging	1.00
IGL01960:Smad2	APN	18	76262484	intron	probably benign
IGL02881:Smad2	APN	18	76299780	splice site	probably null
IGL02977:Smad2	APN	18	76289164	missense	possibly damaging	0.64
R0333:Smad2	UTSW	18	76262621	missense	probably damaging	1.00
R0391:Smad2	UTSW	18	76289037	critical splice acceptor site	probably null
R0523:Smad2	UTSW	18	76262552	missense	probably benign
R0570:Smad2	UTSW	18	76289179	splice site	probably benign
R0624:Smad2	UTSW	18	76299993	missense	probably damaging	1.00
R1573:Smad2	UTSW	18	76262586	missense	possibly damaging	0.89
R1953:Smad2	UTSW	18	76262705	missense	possibly damaging	0.90
R2132:Smad2	UTSW	18	76288084	nonsense	probably null
R2213:Smad2	UTSW	18	76304626	missense	probably damaging	1.00
R3021:Smad2	UTSW	18	76262632	missense	probably damaging	1.00
R3917:Smad2	UTSW	18	76287937	missense	probably benign	0.42
R4503:Smad2	UTSW	18	76302592	missense	probably benign	0.23
R5253:Smad2	UTSW	18	76288053	missense	probably damaging	1.00
R5290:Smad2	UTSW	18	76262724	missense	probably damaging	1.00
R5891:Smad2	UTSW	18	76299975	missense	probably damaging	1.00
R6294:Smad2	UTSW	18	76289162	missense	probably benign	0.31
R6879:Smad2	UTSW	18	76262654	missense	possibly damaging	0.49
R7430:Smad2	UTSW	18	76288080	missense	probably damaging	1.00
R7757:Smad2	UTSW	18	76288013	missense	probably benign	0.40
R8072:Smad2	UTSW	18	76286951	critical splice donor site	probably null
R9132:Smad2	UTSW	18	76262502	missense	possibly damaging	0.87
R9159:Smad2	UTSW	18	76262502	missense	possibly damaging	0.87
R9184:Smad2	UTSW	18	76289100	missense	probably benign	0.00
Z1177:Smad2	UTSW	18	76288002	missense	probably damaging	1.00
Z1177:Smad2	UTSW	18	76288003	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATATAGTGGCTCGTGCTGACC -3'
(R):5'- CATCTTTAATACTGGCACGCTG -3'

Sequencing Primer
(F):5'- TCGTGCTGACCCGTTGG -3'
(R):5'- GGCACGCTGATACTTTACACG -3'

Posted On

2019-10-17