Incidental Mutation 'R7504:Ift80'
ID 581658
Institutional Source Beutler Lab
Gene Symbol Ift80
Ensembl Gene ENSMUSG00000027778
Gene Name intraflagellar transport 80
Synonyms 4921524P20Rik, Wdr56
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock # R7504 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 68892499-69004570 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 68918005 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 539 (Y539C)
Ref Sequence ENSEMBL: ENSMUSP00000133263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029347] [ENSMUST00000107812] [ENSMUST00000169064]
AlphaFold Q8K057
Predicted Effect probably damaging
Transcript: ENSMUST00000029347
AA Change: Y539C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029347
Gene: ENSMUSG00000027778
AA Change: Y539C

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 4e-9 BLAST
WD40 95 134 9.38e-5 SMART
WD40 136 176 2.75e1 SMART
WD40 177 216 1.42e-4 SMART
WD40 219 256 1.56e-1 SMART
WD40 258 297 2.75e1 SMART
low complexity region 429 440 N/A INTRINSIC
Blast:WD40 496 533 4e-18 BLAST
low complexity region 764 772 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107812
AA Change: Y539C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103442
Gene: ENSMUSG00000027778
AA Change: Y539C

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 4e-9 BLAST
WD40 95 134 9.38e-5 SMART
WD40 136 176 2.75e1 SMART
WD40 177 216 1.42e-4 SMART
WD40 219 256 1.56e-1 SMART
WD40 258 297 2.75e1 SMART
low complexity region 429 440 N/A INTRINSIC
Blast:WD40 496 533 4e-18 BLAST
low complexity region 764 772 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169064
AA Change: Y539C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133263
Gene: ENSMUSG00000027778
AA Change: Y539C

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 4e-9 BLAST
WD40 95 134 9.38e-5 SMART
WD40 136 176 2.75e1 SMART
WD40 177 216 1.42e-4 SMART
WD40 219 256 1.56e-1 SMART
WD40 258 297 2.75e1 SMART
low complexity region 429 440 N/A INTRINSIC
Blast:WD40 496 533 4e-18 BLAST
low complexity region 764 772 N/A INTRINSIC
Meta Mutation Damage Score 0.2358 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the intraflagellar transport complex B and is necessary for the function of motile and sensory cilia. Defects in this gene are a cause of asphyxiating thoracic dystrophy 2 (ATD2). Three transcript variants encoding two different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele exhibit partial perinatal lethality, decreased body size, postnatal growth retardation, shortened long bones, constricted thoracic cage, periaxial polydactyly, and small cranium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C G 17: 14,943,653 A14G probably damaging Het
6430573F11Rik A C 8: 36,512,155 N304T probably benign Het
Btn1a1 A T 13: 23,461,716 M161K probably benign Het
Camkk2 G A 5: 122,746,308 T350I probably damaging Het
Cdc42bpg C A 19: 6,306,784 D23E possibly damaging Het
Cdkn1a T C 17: 29,098,514 L36P probably damaging Het
Dek A G 13: 47,088,035 I351T probably damaging Het
Dst T C 1: 34,201,017 Y1816H probably damaging Het
Efl1 T A 7: 82,683,049 N300K probably damaging Het
Ephx2 A G 14: 66,101,617 Y294H probably damaging Het
Fancd2 T A 6: 113,545,038 I198N probably damaging Het
Gm6502 G T 5: 94,317,047 V431L probably benign Het
Grid1 G T 14: 35,562,513 A738S probably damaging Het
Gsx2 G A 5: 75,076,399 probably null Het
Hc G A 2: 35,061,319 T22I not run Het
Hps1 T C 19: 42,766,720 D261G probably benign Het
Insc G T 7: 114,791,298 probably null Het
Isg15 T C 4: 156,200,045 M9V probably damaging Het
Kalrn A G 16: 34,256,233 L695P unknown Het
Nars A C 18: 64,512,022 F52V probably benign Het
Nmt1 T G 11: 103,056,459 F225V probably damaging Het
Olfr1352 A G 10: 78,984,660 Y290C possibly damaging Het
Olfr143 A T 9: 38,254,243 K272N possibly damaging Het
Olfr1495 T A 19: 13,768,732 I130N probably damaging Het
Pbx3 T C 2: 34,175,924 T385A probably damaging Het
Pcdhb11 A T 18: 37,421,799 T61S probably benign Het
Rab11fip1 T C 8: 27,152,953 E606G possibly damaging Het
Rnf216 A G 5: 143,075,759 Y589H probably benign Het
Scara3 A G 14: 65,931,331 I279T possibly damaging Het
Sdk2 T A 11: 113,867,967 Y477F possibly damaging Het
Secisbp2l T C 2: 125,758,171 K415E probably benign Het
Stag1 C T 9: 100,888,328 T639I probably benign Het
Sv2b A T 7: 75,136,383 F430I probably benign Het
Tenm2 C T 11: 36,139,743 C743Y probably damaging Het
Tet2 C A 3: 133,487,339 V445L probably benign Het
Tmem132c T C 5: 127,554,632 S652P probably damaging Het
Togaram1 A G 12: 64,992,617 D1155G possibly damaging Het
Traip T C 9: 107,961,544 I169T probably benign Het
Usp45 T G 4: 21,816,892 M374R possibly damaging Het
Vmn2r81 A T 10: 79,268,332 H263L probably benign Het
Wdr95 T C 5: 149,581,846 V364A probably damaging Het
Zfp128 G A 7: 12,890,478 D258N probably damaging Het
Zfp335 G A 2: 164,909,418 T76I probably benign Het
Zfp688 C A 7: 127,419,311 C214F probably damaging Het
Zfp760 T C 17: 21,722,674 S277P probably damaging Het
Other mutations in Ift80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Ift80 APN 3 68914653 nonsense probably null
IGL01020:Ift80 APN 3 68963679 missense probably damaging 1.00
IGL01544:Ift80 APN 3 68990782 missense probably benign 0.05
IGL01612:Ift80 APN 3 68963663 missense possibly damaging 0.61
IGL01743:Ift80 APN 3 68962296 missense probably benign 0.00
IGL02187:Ift80 APN 3 68985456 missense probably damaging 1.00
IGL02381:Ift80 APN 3 68962320 splice site probably null
IGL02407:Ift80 APN 3 68898536 missense probably benign
IGL02510:Ift80 APN 3 68898543 missense probably benign 0.07
IGL02512:Ift80 APN 3 68927725 critical splice donor site probably null
R0091:Ift80 UTSW 3 68914675 missense probably damaging 1.00
R0212:Ift80 UTSW 3 68940173 missense probably benign 0.05
R0348:Ift80 UTSW 3 68935899 missense probably benign
R0357:Ift80 UTSW 3 68914653 nonsense probably null
R1381:Ift80 UTSW 3 68914783 missense possibly damaging 0.78
R1419:Ift80 UTSW 3 68940198 missense probably damaging 1.00
R1643:Ift80 UTSW 3 68916157 missense probably benign 0.06
R1899:Ift80 UTSW 3 68918513 missense probably benign 0.00
R1926:Ift80 UTSW 3 68916165 missense probably damaging 1.00
R2013:Ift80 UTSW 3 68990784 missense possibly damaging 0.62
R3894:Ift80 UTSW 3 68917999 missense probably damaging 1.00
R4214:Ift80 UTSW 3 68990808 missense possibly damaging 0.64
R4290:Ift80 UTSW 3 68963690 missense probably damaging 0.96
R4303:Ift80 UTSW 3 68894174 missense probably benign 0.15
R4361:Ift80 UTSW 3 68963649 missense probably damaging 1.00
R4576:Ift80 UTSW 3 68950530 missense possibly damaging 0.71
R4596:Ift80 UTSW 3 68990759 missense probably benign 0.01
R4652:Ift80 UTSW 3 68914940 missense probably benign 0.32
R4654:Ift80 UTSW 3 68918537 missense possibly damaging 0.94
R4720:Ift80 UTSW 3 68962290 missense possibly damaging 0.50
R4865:Ift80 UTSW 3 68990759 missense probably benign 0.01
R4885:Ift80 UTSW 3 68950496 missense probably damaging 0.98
R5357:Ift80 UTSW 3 68990780 missense possibly damaging 0.62
R5561:Ift80 UTSW 3 68967863 missense probably benign 0.00
R5589:Ift80 UTSW 3 68930900 missense probably damaging 1.00
R5806:Ift80 UTSW 3 68950476 missense probably benign 0.09
R6910:Ift80 UTSW 3 68927735 missense probably benign 0.01
R6962:Ift80 UTSW 3 68994545 start gained probably benign
R7157:Ift80 UTSW 3 68990944 nonsense probably null
R7452:Ift80 UTSW 3 68994282 splice site probably null
R8077:Ift80 UTSW 3 68916145 missense probably benign 0.01
R8435:Ift80 UTSW 3 68985454 missense probably damaging 1.00
R8821:Ift80 UTSW 3 68962250 missense probably damaging 0.98
R8831:Ift80 UTSW 3 68962250 missense probably damaging 0.98
R8897:Ift80 UTSW 3 68950476 missense probably benign
R9222:Ift80 UTSW 3 68918561 missense possibly damaging 0.58
R9328:Ift80 UTSW 3 68940150 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCAACTGAGCTATCATTAAACAG -3'
(R):5'- AACCCAGAATGGCTCTAGGG -3'

Sequencing Primer
(F):5'- CTGAGCTATCATTAAACAGACCTAAG -3'
(R):5'- AATGGCTCTAGGGAGAACATTC -3'
Posted On 2019-10-17