Incidental Mutation 'R7504:Usp45'
ID581660
Institutional Source Beutler Lab
Gene Symbol Usp45
Ensembl Gene ENSMUSG00000040455
Gene Nameubiquitin specific petidase 45
SynonymsGcap7, 3110003C05Rik, 4930550B20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7504 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location21767156-21837872 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 21816892 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 374 (M374R)
Ref Sequence ENSEMBL: ENSMUSP00000048324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040429] [ENSMUST00000065111] [ENSMUST00000108232] [ENSMUST00000148647]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040429
AA Change: M374R

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000048324
Gene: ENSMUSG00000040455
AA Change: M374R

DomainStartEndE-ValueType
Pfam:zf-UBP 60 139 2e-19 PFAM
Pfam:UCH 190 761 2.8e-50 PFAM
Pfam:UCH_1 533 743 3.9e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000065111
AA Change: M374R

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000067109
Gene: ENSMUSG00000040455
AA Change: M374R

DomainStartEndE-ValueType
Pfam:zf-UBP 60 139 4.1e-19 PFAM
Pfam:UCH 190 809 2.1e-45 PFAM
Pfam:UCH_1 581 790 9.6e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108232
AA Change: M374R

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103867
Gene: ENSMUSG00000040455
AA Change: M374R

DomainStartEndE-ValueType
Pfam:zf-UBP 60 139 2.2e-19 PFAM
Pfam:UCH 190 809 4.6e-50 PFAM
Pfam:UCH_1 582 791 4.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137293
SMART Domains Protein: ENSMUSP00000125982
Gene: ENSMUSG00000040455

DomainStartEndE-ValueType
Pfam:zf-UBP 27 106 1.6e-20 PFAM
Pfam:UCH 157 205 3.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148647
SMART Domains Protein: ENSMUSP00000128859
Gene: ENSMUSG00000040455

DomainStartEndE-ValueType
Pfam:UCH 54 150 4.6e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a deubiquitylase that binds ERCC1, the catalytic subunit of the XPF-ERCC1 DNA repair endonuclease. This endonuclease is a critical regulator of DNA repair processes, and the deubiquitylase activity of the encoded protein is important for maintaining the DNA repair ability of XPF-ERCC1. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C G 17: 14,943,653 A14G probably damaging Het
6430573F11Rik A C 8: 36,512,155 N304T probably benign Het
Btn1a1 A T 13: 23,461,716 M161K probably benign Het
Camkk2 G A 5: 122,746,308 T350I probably damaging Het
Cdc42bpg C A 19: 6,306,784 D23E possibly damaging Het
Cdkn1a T C 17: 29,098,514 L36P probably damaging Het
Dek A G 13: 47,088,035 I351T probably damaging Het
Dst T C 1: 34,201,017 Y1816H probably damaging Het
Efl1 T A 7: 82,683,049 N300K probably damaging Het
Ephx2 A G 14: 66,101,617 Y294H probably damaging Het
Fancd2 T A 6: 113,545,038 I198N probably damaging Het
Gm6502 G T 5: 94,317,047 V431L probably benign Het
Grid1 G T 14: 35,562,513 A738S probably damaging Het
Gsx2 G A 5: 75,076,399 probably null Het
Hc G A 2: 35,061,319 T22I not run Het
Hps1 T C 19: 42,766,720 D261G probably benign Het
Ift80 T C 3: 68,918,005 Y539C probably damaging Het
Insc G T 7: 114,791,298 probably null Het
Isg15 T C 4: 156,200,045 M9V probably damaging Het
Kalrn A G 16: 34,256,233 L695P unknown Het
Nars A C 18: 64,512,022 F52V probably benign Het
Nmt1 T G 11: 103,056,459 F225V probably damaging Het
Olfr1352 A G 10: 78,984,660 Y290C possibly damaging Het
Olfr143 A T 9: 38,254,243 K272N possibly damaging Het
Olfr1495 T A 19: 13,768,732 I130N probably damaging Het
Pbx3 T C 2: 34,175,924 T385A probably damaging Het
Pcdhb11 A T 18: 37,421,799 T61S probably benign Het
Rab11fip1 T C 8: 27,152,953 E606G possibly damaging Het
Rnf216 A G 5: 143,075,759 Y589H probably benign Het
Scara3 A G 14: 65,931,331 I279T possibly damaging Het
Sdk2 T A 11: 113,867,967 Y477F possibly damaging Het
Secisbp2l T C 2: 125,758,171 K415E probably benign Het
Stag1 C T 9: 100,888,328 T639I probably benign Het
Sv2b A T 7: 75,136,383 F430I probably benign Het
Tenm2 C T 11: 36,139,743 C743Y probably damaging Het
Tet2 C A 3: 133,487,339 V445L probably benign Het
Tmem132c T C 5: 127,554,632 S652P probably damaging Het
Togaram1 A G 12: 64,992,617 D1155G possibly damaging Het
Traip T C 9: 107,961,544 I169T probably benign Het
Vmn2r81 A T 10: 79,268,332 H263L probably benign Het
Wdr95 T C 5: 149,581,846 V364A probably damaging Het
Zfp128 G A 7: 12,890,478 D258N probably damaging Het
Zfp335 G A 2: 164,909,418 T76I probably benign Het
Zfp688 C A 7: 127,419,311 C214F probably damaging Het
Zfp760 T C 17: 21,722,674 S277P probably damaging Het
Other mutations in Usp45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02040:Usp45 APN 4 21830433 missense probably benign 0.38
IGL02053:Usp45 APN 4 21824553 missense probably benign 0.43
IGL02155:Usp45 APN 4 21798743 unclassified probably null
R0285:Usp45 UTSW 4 21798603 critical splice acceptor site probably null
R1260:Usp45 UTSW 4 21826204 missense probably damaging 1.00
R1495:Usp45 UTSW 4 21797385 missense possibly damaging 0.82
R1888:Usp45 UTSW 4 21784811 intron probably benign
R2444:Usp45 UTSW 4 21817528 missense probably benign 0.00
R2906:Usp45 UTSW 4 21834338 nonsense probably null
R4058:Usp45 UTSW 4 21810746 missense probably damaging 1.00
R4357:Usp45 UTSW 4 21834350 nonsense probably null
R4386:Usp45 UTSW 4 21830505 critical splice donor site probably null
R4648:Usp45 UTSW 4 21825044 missense probably benign 0.12
R4766:Usp45 UTSW 4 21797307 missense probably damaging 0.98
R4787:Usp45 UTSW 4 21796860 missense probably benign
R4973:Usp45 UTSW 4 21815372 missense probably damaging 1.00
R5152:Usp45 UTSW 4 21824815 missense probably benign 0.41
R5900:Usp45 UTSW 4 21830451 missense probably damaging 1.00
R5960:Usp45 UTSW 4 21810797 missense probably damaging 1.00
R5961:Usp45 UTSW 4 21810797 missense probably damaging 1.00
R6149:Usp45 UTSW 4 21810797 missense probably damaging 1.00
R6150:Usp45 UTSW 4 21810797 missense probably damaging 1.00
R6151:Usp45 UTSW 4 21810797 missense probably damaging 1.00
R6997:Usp45 UTSW 4 21781844 missense probably damaging 1.00
R7565:Usp45 UTSW 4 21784790 missense probably benign 0.00
R7750:Usp45 UTSW 4 21780430 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAATCGGTCAAATGCTTGTC -3'
(R):5'- CAAGGTTAAAAGATTTAATCCCGGG -3'

Sequencing Primer
(F):5'- AAGTTGTCTGAGAGGTTTGA -3'
(R):5'- TATATACTTCATGCACACATACGC -3'
Posted On2019-10-17