Incidental Mutation 'R7504:Usp45'
ID581660
Institutional Source Beutler Lab
Gene Symbol Usp45
Ensembl Gene ENSMUSG00000040455
Gene Nameubiquitin specific petidase 45
SynonymsGcap7, 3110003C05Rik, 4930550B20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7504 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location21767156-21837872 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 21816892 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 374 (M374R)
Ref Sequence ENSEMBL: ENSMUSP00000048324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040429] [ENSMUST00000065111] [ENSMUST00000108232] [ENSMUST00000148647]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040429
AA Change: M374R

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000048324
Gene: ENSMUSG00000040455
AA Change: M374R

DomainStartEndE-ValueType
Pfam:zf-UBP 60 139 2e-19 PFAM
Pfam:UCH 190 761 2.8e-50 PFAM
Pfam:UCH_1 533 743 3.9e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000065111
AA Change: M374R

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000067109
Gene: ENSMUSG00000040455
AA Change: M374R

DomainStartEndE-ValueType
Pfam:zf-UBP 60 139 4.1e-19 PFAM
Pfam:UCH 190 809 2.1e-45 PFAM
Pfam:UCH_1 581 790 9.6e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108232
AA Change: M374R

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103867
Gene: ENSMUSG00000040455
AA Change: M374R

DomainStartEndE-ValueType
Pfam:zf-UBP 60 139 2.2e-19 PFAM
Pfam:UCH 190 809 4.6e-50 PFAM
Pfam:UCH_1 582 791 4.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137293
SMART Domains Protein: ENSMUSP00000125982
Gene: ENSMUSG00000040455

DomainStartEndE-ValueType
Pfam:zf-UBP 27 106 1.6e-20 PFAM
Pfam:UCH 157 205 3.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148647
SMART Domains Protein: ENSMUSP00000128859
Gene: ENSMUSG00000040455

DomainStartEndE-ValueType
Pfam:UCH 54 150 4.6e-9 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a deubiquitylase that binds ERCC1, the catalytic subunit of the XPF-ERCC1 DNA repair endonuclease. This endonuclease is a critical regulator of DNA repair processes, and the deubiquitylase activity of the encoded protein is important for maintaining the DNA repair ability of XPF-ERCC1. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C G 17: 14,943,653 A14G probably damaging Het
6430573F11Rik A C 8: 36,512,155 N304T probably benign Het
Btn1a1 A T 13: 23,461,716 M161K probably benign Het
Camkk2 G A 5: 122,746,308 T350I probably damaging Het
Cdc42bpg C A 19: 6,306,784 D23E possibly damaging Het
Cdkn1a T C 17: 29,098,514 L36P probably damaging Het
Dek A G 13: 47,088,035 I351T probably damaging Het
Dst T C 1: 34,201,017 Y1816H probably damaging Het
Efl1 T A 7: 82,683,049 N300K probably damaging Het
Ephx2 A G 14: 66,101,617 Y294H probably damaging Het
Fancd2 T A 6: 113,545,038 I198N probably damaging Het
Gm6502 G T 5: 94,317,047 V431L probably benign Het
Grid1 G T 14: 35,562,513 A738S probably damaging Het
Gsx2 G A 5: 75,076,399 probably null Het
Hc G A 2: 35,061,319 T22I not run Het
Hps1 T C 19: 42,766,720 D261G probably benign Het
Ift80 T C 3: 68,918,005 Y539C probably damaging Het
Insc G T 7: 114,791,298 probably null Het
Isg15 T C 4: 156,200,045 M9V probably damaging Het
Kalrn A G 16: 34,256,233 L695P unknown Het
Nars A C 18: 64,512,022 F52V probably benign Het
Nmt1 T G 11: 103,056,459 F225V probably damaging Het
Olfr1352 A G 10: 78,984,660 Y290C possibly damaging Het
Olfr143 A T 9: 38,254,243 K272N possibly damaging Het
Olfr1495 T A 19: 13,768,732 I130N probably damaging Het
Pbx3 T C 2: 34,175,924 T385A probably damaging Het
Pcdhb11 A T 18: 37,421,799 T61S probably benign Het
Rab11fip1 T C 8: 27,152,953 E606G possibly damaging Het
Rnf216 A G 5: 143,075,759 Y589H probably benign Het
Scara3 A G 14: 65,931,331 I279T possibly damaging Het
Sdk2 T A 11: 113,867,967 Y477F possibly damaging Het
Secisbp2l T C 2: 125,758,171 K415E probably benign Het
Stag1 C T 9: 100,888,328 T639I probably benign Het
Sv2b A T 7: 75,136,383 F430I probably benign Het
Tenm2 C T 11: 36,139,743 C743Y probably damaging Het
Tet2 C A 3: 133,487,339 V445L probably benign Het
Tmem132c T C 5: 127,554,632 S652P probably damaging Het
Togaram1 A G 12: 64,992,617 D1155G possibly damaging Het
Traip T C 9: 107,961,544 I169T probably benign Het
Vmn2r81 A T 10: 79,268,332 H263L probably benign Het
Wdr95 T C 5: 149,581,846 V364A probably damaging Het
Zfp128 G A 7: 12,890,478 D258N probably damaging Het
Zfp335 G A 2: 164,909,418 T76I probably benign Het
Zfp688 C A 7: 127,419,311 C214F probably damaging Het
Zfp760 T C 17: 21,722,674 S277P probably damaging Het
Other mutations in Usp45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02040:Usp45 APN 4 21830433 missense probably benign 0.38
IGL02053:Usp45 APN 4 21824553 missense probably benign 0.43
IGL02155:Usp45 APN 4 21798743 splice site probably null
R0285:Usp45 UTSW 4 21798603 critical splice acceptor site probably null
R1260:Usp45 UTSW 4 21826204 missense probably damaging 1.00
R1495:Usp45 UTSW 4 21797385 missense possibly damaging 0.82
R1888:Usp45 UTSW 4 21784811 intron probably benign
R2444:Usp45 UTSW 4 21817528 missense probably benign 0.00
R2906:Usp45 UTSW 4 21834338 nonsense probably null
R4058:Usp45 UTSW 4 21810746 missense probably damaging 1.00
R4357:Usp45 UTSW 4 21834350 nonsense probably null
R4386:Usp45 UTSW 4 21830505 critical splice donor site probably null
R4648:Usp45 UTSW 4 21825044 missense probably benign 0.12
R4766:Usp45 UTSW 4 21797307 missense probably damaging 0.98
R4787:Usp45 UTSW 4 21796860 missense probably benign
R4973:Usp45 UTSW 4 21815372 missense probably damaging 1.00
R5152:Usp45 UTSW 4 21824815 missense probably benign 0.41
R5900:Usp45 UTSW 4 21830451 missense probably damaging 1.00
R5960:Usp45 UTSW 4 21810797 missense probably damaging 1.00
R5961:Usp45 UTSW 4 21810797 missense probably damaging 1.00
R6149:Usp45 UTSW 4 21810797 missense probably damaging 1.00
R6150:Usp45 UTSW 4 21810797 missense probably damaging 1.00
R6151:Usp45 UTSW 4 21810797 missense probably damaging 1.00
R6997:Usp45 UTSW 4 21781844 missense probably damaging 1.00
R7565:Usp45 UTSW 4 21784790 missense probably benign 0.00
R7750:Usp45 UTSW 4 21780430 missense probably damaging 1.00
R7992:Usp45 UTSW 4 21824543 missense probably benign 0.02
R8043:Usp45 UTSW 4 21824543 missense probably benign 0.02
R8233:Usp45 UTSW 4 21781736 missense probably benign 0.33
R8237:Usp45 UTSW 4 21834274 missense probably damaging 0.98
R8868:Usp45 UTSW 4 21815399 critical splice donor site probably null
R8883:Usp45 UTSW 4 21825006 missense probably damaging 1.00
Z1176:Usp45 UTSW 4 21796847 missense possibly damaging 0.87
Z1176:Usp45 UTSW 4 21817613 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AGAAATCGGTCAAATGCTTGTC -3'
(R):5'- CAAGGTTAAAAGATTTAATCCCGGG -3'

Sequencing Primer
(F):5'- AAGTTGTCTGAGAGGTTTGA -3'
(R):5'- TATATACTTCATGCACACATACGC -3'
Posted On2019-10-17