Incidental Mutation 'R7504:Isg15'
ID581661
Institutional Source Beutler Lab
Gene Symbol Isg15
Ensembl Gene ENSMUSG00000035692
Gene NameISG15 ubiquitin-like modifier
SynonymsG1p2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7504 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location156199424-156200818 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 156200045 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 9 (M9V)
Ref Sequence ENSEMBL: ENSMUSP00000082548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085425] [ENSMUST00000105140] [ENSMUST00000180572]
Predicted Effect probably damaging
Transcript: ENSMUST00000085425
AA Change: M9V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000082548
Gene: ENSMUSG00000035692
AA Change: M9V

DomainStartEndE-ValueType
UBQ 3 74 8.2e-24 SMART
UBQ 80 151 2.93e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105140
SMART Domains Protein: ENSMUSP00000100772
Gene: ENSMUSG00000078349

DomainStartEndE-ValueType
low complexity region 95 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180572
SMART Domains Protein: ENSMUSP00000137931
Gene: ENSMUSG00000041936

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:NtA 32 159 5.1e-91 PFAM
FOLN 173 198 8.25e-6 SMART
KAZAL 198 244 1.22e-17 SMART
FOLN 249 273 7.58e-5 SMART
EGF_like 249 288 7.38e1 SMART
KAZAL 273 319 1.51e-13 SMART
KAZAL 348 391 1.8e-6 SMART
KAZAL 417 463 1.55e-10 SMART
FOLN 469 491 8.25e-6 SMART
KAZAL 491 536 1.14e-17 SMART
KAZAL 556 601 6.43e-17 SMART
FOLN 603 626 2.94e-2 SMART
KAZAL 614 666 8.96e-16 SMART
low complexity region 672 679 N/A INTRINSIC
KAZAL 706 752 1.12e-16 SMART
EGF_Lam 795 846 3.29e-15 SMART
EGF_Lam 849 893 6.7e-7 SMART
FOLN 902 924 1.94e-2 SMART
KAZAL 924 971 3.9e-16 SMART
low complexity region 996 1013 N/A INTRINSIC
low complexity region 1056 1085 N/A INTRINSIC
SEA 1121 1243 2.26e-35 SMART
low complexity region 1249 1276 N/A INTRINSIC
low complexity region 1290 1305 N/A INTRINSIC
EGF 1321 1356 1.49e-4 SMART
LamG 1381 1517 4e-45 SMART
EGF 1541 1575 2.23e-3 SMART
EGF 1580 1614 7.13e-2 SMART
LamG 1649 1785 6.51e-36 SMART
EGF 1806 1842 4.35e-6 SMART
LamG 1878 2014 5.01e-37 SMART
Meta Mutation Damage Score 0.0838 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitin-like protein that is conjugated to intracellular target proteins upon activation by interferon-alpha and interferon-beta. Several functions have been ascribed to the encoded protein, including chemotactic activity towards neutrophils, direction of ligated target proteins to intermediate filaments, cell-to-cell signaling, and antiviral activity during viral infections. While conjugates of this protein have been found to be noncovalently attached to intermediate filaments, this protein is sometimes secreted. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous null mice are viable and fertile and do not display immunological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C G 17: 14,943,653 A14G probably damaging Het
6430573F11Rik A C 8: 36,512,155 N304T probably benign Het
Btn1a1 A T 13: 23,461,716 M161K probably benign Het
Camkk2 G A 5: 122,746,308 T350I probably damaging Het
Cdc42bpg C A 19: 6,306,784 D23E possibly damaging Het
Cdkn1a T C 17: 29,098,514 L36P probably damaging Het
Dek A G 13: 47,088,035 I351T probably damaging Het
Dst T C 1: 34,201,017 Y1816H probably damaging Het
Efl1 T A 7: 82,683,049 N300K probably damaging Het
Ephx2 A G 14: 66,101,617 Y294H probably damaging Het
Fancd2 T A 6: 113,545,038 I198N probably damaging Het
Gm6502 G T 5: 94,317,047 V431L probably benign Het
Grid1 G T 14: 35,562,513 A738S probably damaging Het
Gsx2 G A 5: 75,076,399 probably null Het
Hc G A 2: 35,061,319 T22I not run Het
Hps1 T C 19: 42,766,720 D261G probably benign Het
Ift80 T C 3: 68,918,005 Y539C probably damaging Het
Insc G T 7: 114,791,298 probably null Het
Kalrn A G 16: 34,256,233 L695P unknown Het
Nars A C 18: 64,512,022 F52V probably benign Het
Nmt1 T G 11: 103,056,459 F225V probably damaging Het
Olfr1352 A G 10: 78,984,660 Y290C possibly damaging Het
Olfr143 A T 9: 38,254,243 K272N possibly damaging Het
Olfr1495 T A 19: 13,768,732 I130N probably damaging Het
Pbx3 T C 2: 34,175,924 T385A probably damaging Het
Pcdhb11 A T 18: 37,421,799 T61S probably benign Het
Rab11fip1 T C 8: 27,152,953 E606G possibly damaging Het
Rnf216 A G 5: 143,075,759 Y589H probably benign Het
Scara3 A G 14: 65,931,331 I279T possibly damaging Het
Sdk2 T A 11: 113,867,967 Y477F possibly damaging Het
Secisbp2l T C 2: 125,758,171 K415E probably benign Het
Stag1 C T 9: 100,888,328 T639I probably benign Het
Sv2b A T 7: 75,136,383 F430I probably benign Het
Tenm2 C T 11: 36,139,743 C743Y probably damaging Het
Tet2 C A 3: 133,487,339 V445L probably benign Het
Tmem132c T C 5: 127,554,632 S652P probably damaging Het
Togaram1 A G 12: 64,992,617 D1155G possibly damaging Het
Traip T C 9: 107,961,544 I169T probably benign Het
Usp45 T G 4: 21,816,892 M374R possibly damaging Het
Vmn2r81 A T 10: 79,268,332 H263L probably benign Het
Wdr95 T C 5: 149,581,846 V364A probably damaging Het
Zfp128 G A 7: 12,890,478 D258N probably damaging Het
Zfp335 G A 2: 164,909,418 T76I probably benign Het
Zfp688 C A 7: 127,419,311 C214F probably damaging Het
Zfp760 T C 17: 21,722,674 S277P probably damaging Het
Other mutations in Isg15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01757:Isg15 APN 4 156199844 missense probably damaging 1.00
IGL03280:Isg15 APN 4 156199862 missense probably benign 0.02
R0787:Isg15 UTSW 4 156199939 missense probably benign 0.19
R1703:Isg15 UTSW 4 156199808 missense possibly damaging 0.89
R1714:Isg15 UTSW 4 156199957 missense probably damaging 1.00
R1757:Isg15 UTSW 4 156199990 missense possibly damaging 0.52
R1984:Isg15 UTSW 4 156199793 missense probably benign 0.00
R2044:Isg15 UTSW 4 156199792 missense probably benign 0.43
R2431:Isg15 UTSW 4 156200701 splice site probably null
R4738:Isg15 UTSW 4 156199862 missense probably benign 0.02
R4911:Isg15 UTSW 4 156199760 missense probably benign 0.00
R4997:Isg15 UTSW 4 156199697 missense possibly damaging 0.58
R5692:Isg15 UTSW 4 156199822 missense probably damaging 1.00
R8338:Isg15 UTSW 4 156199631 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACTAGCATCACTGTGCTGC -3'
(R):5'- TCCCAGCCAAAGTTGCTAAGC -3'

Sequencing Primer
(F):5'- ATCACTGTGCTGCTGGGAC -3'
(R):5'- CTGAATGACCTTCTGACAGGAGTC -3'
Posted On2019-10-17