Incidental Mutation 'R7504:Tmem132c'
ID581664
Institutional Source Beutler Lab
Gene Symbol Tmem132c
Ensembl Gene ENSMUSG00000034324
Gene Nametransmembrane protein 132C
Synonyms2810482M11Rik, 4632425D07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7504 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location127241808-127565793 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127554632 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 652 (S652P)
Ref Sequence ENSEMBL: ENSMUSP00000113090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119026]
Predicted Effect probably damaging
Transcript: ENSMUST00000119026
AA Change: S652P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113090
Gene: ENSMUSG00000034324
AA Change: S652P

DomainStartEndE-ValueType
low complexity region 14 21 N/A INTRINSIC
Pfam:TMEM132D_N 58 187 1.2e-54 PFAM
Pfam:TMEM132 444 787 4.5e-143 PFAM
Pfam:TMEM132D_C 892 980 2.4e-39 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000121783
Gene: ENSMUSG00000034324
AA Change: S34P

DomainStartEndE-ValueType
Pfam:TMEM132 1 112 6.2e-31 PFAM
Meta Mutation Damage Score 0.5899 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C G 17: 14,943,653 A14G probably damaging Het
6430573F11Rik A C 8: 36,512,155 N304T probably benign Het
Btn1a1 A T 13: 23,461,716 M161K probably benign Het
Camkk2 G A 5: 122,746,308 T350I probably damaging Het
Cdc42bpg C A 19: 6,306,784 D23E possibly damaging Het
Cdkn1a T C 17: 29,098,514 L36P probably damaging Het
Dek A G 13: 47,088,035 I351T probably damaging Het
Dst T C 1: 34,201,017 Y1816H probably damaging Het
Efl1 T A 7: 82,683,049 N300K probably damaging Het
Ephx2 A G 14: 66,101,617 Y294H probably damaging Het
Fancd2 T A 6: 113,545,038 I198N probably damaging Het
Gm6502 G T 5: 94,317,047 V431L probably benign Het
Grid1 G T 14: 35,562,513 A738S probably damaging Het
Gsx2 G A 5: 75,076,399 probably null Het
Hc G A 2: 35,061,319 T22I not run Het
Hps1 T C 19: 42,766,720 D261G probably benign Het
Ift80 T C 3: 68,918,005 Y539C probably damaging Het
Insc G T 7: 114,791,298 probably null Het
Isg15 T C 4: 156,200,045 M9V probably damaging Het
Kalrn A G 16: 34,256,233 L695P unknown Het
Nars A C 18: 64,512,022 F52V probably benign Het
Nmt1 T G 11: 103,056,459 F225V probably damaging Het
Olfr1352 A G 10: 78,984,660 Y290C possibly damaging Het
Olfr143 A T 9: 38,254,243 K272N possibly damaging Het
Olfr1495 T A 19: 13,768,732 I130N probably damaging Het
Pbx3 T C 2: 34,175,924 T385A probably damaging Het
Pcdhb11 A T 18: 37,421,799 T61S probably benign Het
Rab11fip1 T C 8: 27,152,953 E606G possibly damaging Het
Rnf216 A G 5: 143,075,759 Y589H probably benign Het
Scara3 A G 14: 65,931,331 I279T possibly damaging Het
Sdk2 T A 11: 113,867,967 Y477F possibly damaging Het
Secisbp2l T C 2: 125,758,171 K415E probably benign Het
Stag1 C T 9: 100,888,328 T639I probably benign Het
Sv2b A T 7: 75,136,383 F430I probably benign Het
Tenm2 C T 11: 36,139,743 C743Y probably damaging Het
Tet2 C A 3: 133,487,339 V445L probably benign Het
Togaram1 A G 12: 64,992,617 D1155G possibly damaging Het
Traip T C 9: 107,961,544 I169T probably benign Het
Usp45 T G 4: 21,816,892 M374R possibly damaging Het
Vmn2r81 A T 10: 79,268,332 H263L probably benign Het
Wdr95 T C 5: 149,581,846 V364A probably damaging Het
Zfp128 G A 7: 12,890,478 D258N probably damaging Het
Zfp335 G A 2: 164,909,418 T76I probably benign Het
Zfp688 C A 7: 127,419,311 C214F probably damaging Het
Zfp760 T C 17: 21,722,674 S277P probably damaging Het
Other mutations in Tmem132c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Tmem132c APN 5 127563242 missense possibly damaging 0.95
IGL00985:Tmem132c APN 5 127504866 missense probably damaging 0.99
IGL01599:Tmem132c APN 5 127359552 splice site probably benign
IGL01750:Tmem132c APN 5 127462959 missense possibly damaging 0.91
IGL01893:Tmem132c APN 5 127463029 missense possibly damaging 0.51
IGL02143:Tmem132c APN 5 127563402 missense probably benign 0.03
IGL02164:Tmem132c APN 5 127536377 missense probably damaging 1.00
IGL02252:Tmem132c APN 5 127462927 missense possibly damaging 0.91
IGL02527:Tmem132c APN 5 127359611 missense possibly damaging 0.95
IGL02584:Tmem132c APN 5 127504999 missense probably damaging 1.00
IGL02878:Tmem132c APN 5 127563090 missense probably damaging 0.99
IGL03065:Tmem132c APN 5 127563624 missense probably damaging 1.00
IGL03120:Tmem132c APN 5 127563384 missense probably benign 0.06
IGL03380:Tmem132c APN 5 127536442 missense probably benign 0.00
IGL03387:Tmem132c APN 5 127563720 missense probably benign 0.00
R0106:Tmem132c UTSW 5 127554669 missense possibly damaging 0.94
R0106:Tmem132c UTSW 5 127554669 missense possibly damaging 0.94
R0415:Tmem132c UTSW 5 127563705 missense probably damaging 1.00
R0607:Tmem132c UTSW 5 127563553 nonsense probably null
R1413:Tmem132c UTSW 5 127563567 missense probably damaging 1.00
R1531:Tmem132c UTSW 5 127359891 missense probably damaging 1.00
R1648:Tmem132c UTSW 5 127463056 splice site probably benign
R2148:Tmem132c UTSW 5 127462962 missense probably damaging 1.00
R2149:Tmem132c UTSW 5 127462962 missense probably damaging 1.00
R2259:Tmem132c UTSW 5 127504924 missense probably benign 0.01
R3853:Tmem132c UTSW 5 127359869 missense probably benign 0.00
R4204:Tmem132c UTSW 5 127563765 missense possibly damaging 0.73
R4543:Tmem132c UTSW 5 127504977 missense probably benign 0.00
R4701:Tmem132c UTSW 5 127564496 unclassified probably benign
R5017:Tmem132c UTSW 5 127563350 missense probably benign 0.13
R5037:Tmem132c UTSW 5 127553135 missense probably benign 0.42
R5327:Tmem132c UTSW 5 127563752 missense possibly damaging 0.50
R5423:Tmem132c UTSW 5 127563843 missense probably benign 0.02
R5548:Tmem132c UTSW 5 127551523 nonsense probably null
R6425:Tmem132c UTSW 5 127553265 missense possibly damaging 0.95
R6717:Tmem132c UTSW 5 127564029 missense possibly damaging 0.93
R6899:Tmem132c UTSW 5 127551680 missense probably damaging 1.00
R7007:Tmem132c UTSW 5 127359615 missense probably damaging 1.00
R7297:Tmem132c UTSW 5 127360217 missense probably benign 0.06
R7326:Tmem132c UTSW 5 127564059 missense possibly damaging 0.51
R7386:Tmem132c UTSW 5 127563926 missense probably benign 0.16
R7640:Tmem132c UTSW 5 127563006 missense probably damaging 1.00
R7718:Tmem132c UTSW 5 127563440 missense probably benign 0.06
R7762:Tmem132c UTSW 5 127554696 missense possibly damaging 0.90
R7818:Tmem132c UTSW 5 127564088 makesense probably null
R8117:Tmem132c UTSW 5 127360112 missense probably benign 0.22
R8425:Tmem132c UTSW 5 127564357 missense
R8749:Tmem132c UTSW 5 127359939 missense possibly damaging 0.75
R8771:Tmem132c UTSW 5 127360128 missense probably benign 0.00
R8798:Tmem132c UTSW 5 127360153 nonsense probably null
X0067:Tmem132c UTSW 5 127536407 missense possibly damaging 0.79
Z1088:Tmem132c UTSW 5 127504921 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GCTCAACAAAGGCTCAGTATGG -3'
(R):5'- ACCCTGAACCTGGCCATATC -3'

Sequencing Primer
(F):5'- GCTCAGTATGGGATCATTAACAGTG -3'
(R):5'- GAACCTGGCCATATCCCCTTC -3'
Posted On2019-10-17