Incidental Mutation 'R7504:Tmem132c'
ID 581664
Institutional Source Beutler Lab
Gene Symbol Tmem132c
Ensembl Gene ENSMUSG00000034324
Gene Name transmembrane protein 132C
Synonyms 2810482M11Rik, 4632425D07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R7504 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 127241808-127565793 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 127554632 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 652 (S652P)
Ref Sequence ENSEMBL: ENSMUSP00000113090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119026]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000119026
AA Change: S652P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113090
Gene: ENSMUSG00000034324
AA Change: S652P

DomainStartEndE-ValueType
low complexity region 14 21 N/A INTRINSIC
Pfam:TMEM132D_N 58 187 1.2e-54 PFAM
Pfam:TMEM132 444 787 4.5e-143 PFAM
Pfam:TMEM132D_C 892 980 2.4e-39 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000121783
Gene: ENSMUSG00000034324
AA Change: S34P

DomainStartEndE-ValueType
Pfam:TMEM132 1 112 6.2e-31 PFAM
Meta Mutation Damage Score 0.5899 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C G 17: 14,943,653 A14G probably damaging Het
6430573F11Rik A C 8: 36,512,155 N304T probably benign Het
Btn1a1 A T 13: 23,461,716 M161K probably benign Het
Camkk2 G A 5: 122,746,308 T350I probably damaging Het
Cdc42bpg C A 19: 6,306,784 D23E possibly damaging Het
Cdkn1a T C 17: 29,098,514 L36P probably damaging Het
Dek A G 13: 47,088,035 I351T probably damaging Het
Dst T C 1: 34,201,017 Y1816H probably damaging Het
Efl1 T A 7: 82,683,049 N300K probably damaging Het
Ephx2 A G 14: 66,101,617 Y294H probably damaging Het
Fancd2 T A 6: 113,545,038 I198N probably damaging Het
Gm6502 G T 5: 94,317,047 V431L probably benign Het
Grid1 G T 14: 35,562,513 A738S probably damaging Het
Gsx2 G A 5: 75,076,399 probably null Het
Hc G A 2: 35,061,319 T22I not run Het
Hps1 T C 19: 42,766,720 D261G probably benign Het
Ift80 T C 3: 68,918,005 Y539C probably damaging Het
Insc G T 7: 114,791,298 probably null Het
Isg15 T C 4: 156,200,045 M9V probably damaging Het
Kalrn A G 16: 34,256,233 L695P unknown Het
Nars A C 18: 64,512,022 F52V probably benign Het
Nmt1 T G 11: 103,056,459 F225V probably damaging Het
Olfr1352 A G 10: 78,984,660 Y290C possibly damaging Het
Olfr143 A T 9: 38,254,243 K272N possibly damaging Het
Olfr1495 T A 19: 13,768,732 I130N probably damaging Het
Pbx3 T C 2: 34,175,924 T385A probably damaging Het
Pcdhb11 A T 18: 37,421,799 T61S probably benign Het
Rab11fip1 T C 8: 27,152,953 E606G possibly damaging Het
Rnf216 A G 5: 143,075,759 Y589H probably benign Het
Scara3 A G 14: 65,931,331 I279T possibly damaging Het
Sdk2 T A 11: 113,867,967 Y477F possibly damaging Het
Secisbp2l T C 2: 125,758,171 K415E probably benign Het
Stag1 C T 9: 100,888,328 T639I probably benign Het
Sv2b A T 7: 75,136,383 F430I probably benign Het
Tenm2 C T 11: 36,139,743 C743Y probably damaging Het
Tet2 C A 3: 133,487,339 V445L probably benign Het
Togaram1 A G 12: 64,992,617 D1155G possibly damaging Het
Traip T C 9: 107,961,544 I169T probably benign Het
Usp45 T G 4: 21,816,892 M374R possibly damaging Het
Vmn2r81 A T 10: 79,268,332 H263L probably benign Het
Wdr95 T C 5: 149,581,846 V364A probably damaging Het
Zfp128 G A 7: 12,890,478 D258N probably damaging Het
Zfp335 G A 2: 164,909,418 T76I probably benign Het
Zfp688 C A 7: 127,419,311 C214F probably damaging Het
Zfp760 T C 17: 21,722,674 S277P probably damaging Het
Other mutations in Tmem132c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Tmem132c APN 5 127563242 missense possibly damaging 0.95
IGL00985:Tmem132c APN 5 127504866 missense probably damaging 0.99
IGL01599:Tmem132c APN 5 127359552 splice site probably benign
IGL01750:Tmem132c APN 5 127462959 missense possibly damaging 0.91
IGL01893:Tmem132c APN 5 127463029 missense possibly damaging 0.51
IGL02143:Tmem132c APN 5 127563402 missense probably benign 0.03
IGL02164:Tmem132c APN 5 127536377 missense probably damaging 1.00
IGL02252:Tmem132c APN 5 127462927 missense possibly damaging 0.91
IGL02527:Tmem132c APN 5 127359611 missense possibly damaging 0.95
IGL02584:Tmem132c APN 5 127504999 missense probably damaging 1.00
IGL02878:Tmem132c APN 5 127563090 missense probably damaging 0.99
IGL03065:Tmem132c APN 5 127563624 missense probably damaging 1.00
IGL03120:Tmem132c APN 5 127563384 missense probably benign 0.06
IGL03380:Tmem132c APN 5 127536442 missense probably benign 0.00
IGL03387:Tmem132c APN 5 127563720 missense probably benign 0.00
R0106:Tmem132c UTSW 5 127554669 missense possibly damaging 0.94
R0106:Tmem132c UTSW 5 127554669 missense possibly damaging 0.94
R0415:Tmem132c UTSW 5 127563705 missense probably damaging 1.00
R0607:Tmem132c UTSW 5 127563553 nonsense probably null
R1413:Tmem132c UTSW 5 127563567 missense probably damaging 1.00
R1531:Tmem132c UTSW 5 127359891 missense probably damaging 1.00
R1648:Tmem132c UTSW 5 127463056 splice site probably benign
R2148:Tmem132c UTSW 5 127462962 missense probably damaging 1.00
R2149:Tmem132c UTSW 5 127462962 missense probably damaging 1.00
R2259:Tmem132c UTSW 5 127504924 missense probably benign 0.01
R3853:Tmem132c UTSW 5 127359869 missense probably benign 0.00
R4204:Tmem132c UTSW 5 127563765 missense possibly damaging 0.73
R4543:Tmem132c UTSW 5 127504977 missense probably benign 0.00
R4701:Tmem132c UTSW 5 127564496 unclassified probably benign
R5017:Tmem132c UTSW 5 127563350 missense probably benign 0.13
R5037:Tmem132c UTSW 5 127553135 missense probably benign 0.42
R5327:Tmem132c UTSW 5 127563752 missense possibly damaging 0.50
R5423:Tmem132c UTSW 5 127563843 missense probably benign 0.02
R5548:Tmem132c UTSW 5 127551523 nonsense probably null
R6425:Tmem132c UTSW 5 127553265 missense possibly damaging 0.95
R6717:Tmem132c UTSW 5 127564029 missense possibly damaging 0.93
R6899:Tmem132c UTSW 5 127551680 missense probably damaging 1.00
R7007:Tmem132c UTSW 5 127359615 missense probably damaging 1.00
R7297:Tmem132c UTSW 5 127360217 missense probably benign 0.06
R7326:Tmem132c UTSW 5 127564059 missense possibly damaging 0.51
R7386:Tmem132c UTSW 5 127563926 missense probably benign 0.16
R7640:Tmem132c UTSW 5 127563006 missense probably damaging 1.00
R7718:Tmem132c UTSW 5 127563440 missense probably benign 0.06
R7762:Tmem132c UTSW 5 127554696 missense possibly damaging 0.90
R7818:Tmem132c UTSW 5 127564088 makesense probably null
R8117:Tmem132c UTSW 5 127360112 missense probably benign 0.22
R8425:Tmem132c UTSW 5 127564357 missense
R8749:Tmem132c UTSW 5 127359939 missense possibly damaging 0.75
R8771:Tmem132c UTSW 5 127360128 missense probably benign 0.00
R8798:Tmem132c UTSW 5 127360153 nonsense probably null
R9372:Tmem132c UTSW 5 127563081 missense probably damaging 1.00
X0067:Tmem132c UTSW 5 127536407 missense possibly damaging 0.79
Z1088:Tmem132c UTSW 5 127504921 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GCTCAACAAAGGCTCAGTATGG -3'
(R):5'- ACCCTGAACCTGGCCATATC -3'

Sequencing Primer
(F):5'- GCTCAGTATGGGATCATTAACAGTG -3'
(R):5'- GAACCTGGCCATATCCCCTTC -3'
Posted On 2019-10-17