Incidental Mutation 'R7504:Rnf216'
ID 581665
Institutional Source Beutler Lab
Gene Symbol Rnf216
Ensembl Gene ENSMUSG00000045078
Gene Name ring finger protein 216
Synonyms 2810055G22Rik, F830018F18Rik, UIP83, Ubce7ip1
MMRRC Submission 045577-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7504 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 142976648-143098749 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 143061514 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 589 (Y589H)
Ref Sequence ENSEMBL: ENSMUSP00000143705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053498] [ENSMUST00000197296] [ENSMUST00000200430] [ENSMUST00000200607]
AlphaFold P58283
Predicted Effect probably benign
Transcript: ENSMUST00000053498
AA Change: Y532H

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000052563
Gene: ENSMUSG00000045078
AA Change: Y532H

DomainStartEndE-ValueType
Blast:RING 560 620 4e-6 BLAST
IBR 629 693 6.82e-5 SMART
IBR 702 769 1.79e-1 SMART
low complexity region 786 803 N/A INTRINSIC
low complexity region 842 866 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197296
Predicted Effect probably benign
Transcript: ENSMUST00000200430
Predicted Effect probably benign
Transcript: ENSMUST00000200607
AA Change: Y589H

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143705
Gene: ENSMUSG00000045078
AA Change: Y589H

DomainStartEndE-ValueType
Blast:RING 560 620 4e-6 BLAST
IBR 629 693 6.82e-5 SMART
IBR 702 769 1.79e-1 SMART
low complexity region 786 803 N/A INTRINSIC
low complexity region 842 866 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which specifically colocalizes and interacts with the serine/threonine protein kinase, receptor-interacting protein (RIP). Zinc finger domains of the encoded protein are required for its interaction with RIP and for inhibition of TNF- and IL1-induced NF-kappa B activation pathways. The encoded protein may also function as an E3 ubiquitin-protein ligase which accepts ubiquitin from E2 ubiquitin-conjugating enzymes and transfers it to substrates. Several alternatively spliced transcript variants have been described for this locus but the full-length natures of only some are known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C G 17: 15,163,915 (GRCm39) A14G probably damaging Het
Btn1a1 A T 13: 23,645,886 (GRCm39) M161K probably benign Het
Camkk2 G A 5: 122,884,371 (GRCm39) T350I probably damaging Het
Cdc42bpg C A 19: 6,356,814 (GRCm39) D23E possibly damaging Het
Cdkn1a T C 17: 29,317,488 (GRCm39) L36P probably damaging Het
Dek A G 13: 47,241,511 (GRCm39) I351T probably damaging Het
Dst T C 1: 34,240,098 (GRCm39) Y1816H probably damaging Het
Efl1 T A 7: 82,332,257 (GRCm39) N300K probably damaging Het
Ephx2 A G 14: 66,339,066 (GRCm39) Y294H probably damaging Het
Fancd2 T A 6: 113,521,999 (GRCm39) I198N probably damaging Het
Grid1 G T 14: 35,284,470 (GRCm39) A738S probably damaging Het
Gsx2 G A 5: 75,237,060 (GRCm39) probably null Het
Hc G A 2: 34,951,331 (GRCm39) T22I not run Het
Hps1 T C 19: 42,755,159 (GRCm39) D261G probably benign Het
Ift80 T C 3: 68,825,338 (GRCm39) Y539C probably damaging Het
Insc G T 7: 114,390,533 (GRCm39) probably null Het
Isg15 T C 4: 156,284,502 (GRCm39) M9V probably damaging Het
Kalrn A G 16: 34,076,603 (GRCm39) L695P unknown Het
Nars1 A C 18: 64,645,093 (GRCm39) F52V probably benign Het
Nmt1 T G 11: 102,947,285 (GRCm39) F225V probably damaging Het
Or10q12 T A 19: 13,746,096 (GRCm39) I130N probably damaging Het
Or7a36 A G 10: 78,820,494 (GRCm39) Y290C possibly damaging Het
Or8c8 A T 9: 38,165,539 (GRCm39) K272N possibly damaging Het
Pbx3 T C 2: 34,065,936 (GRCm39) T385A probably damaging Het
Pcdhb11 A T 18: 37,554,852 (GRCm39) T61S probably benign Het
Pramel40 G T 5: 94,464,906 (GRCm39) V431L probably benign Het
Rab11fip1 T C 8: 27,642,981 (GRCm39) E606G possibly damaging Het
Scara3 A G 14: 66,168,780 (GRCm39) I279T possibly damaging Het
Sdk2 T A 11: 113,758,793 (GRCm39) Y477F possibly damaging Het
Secisbp2l T C 2: 125,600,091 (GRCm39) K415E probably benign Het
Stag1 C T 9: 100,770,381 (GRCm39) T639I probably benign Het
Sv2b A T 7: 74,786,131 (GRCm39) F430I probably benign Het
Tenm2 C T 11: 36,030,570 (GRCm39) C743Y probably damaging Het
Tet2 C A 3: 133,193,100 (GRCm39) V445L probably benign Het
Tmem132c T C 5: 127,631,696 (GRCm39) S652P probably damaging Het
Togaram1 A G 12: 65,039,391 (GRCm39) D1155G possibly damaging Het
Traip T C 9: 107,838,743 (GRCm39) I169T probably benign Het
Trmt9b A C 8: 36,979,309 (GRCm39) N304T probably benign Het
Usp45 T G 4: 21,816,892 (GRCm39) M374R possibly damaging Het
Vmn2r81 A T 10: 79,104,166 (GRCm39) H263L probably benign Het
Wdr95 T C 5: 149,505,311 (GRCm39) V364A probably damaging Het
Zfp128 G A 7: 12,624,405 (GRCm39) D258N probably damaging Het
Zfp335 G A 2: 164,751,338 (GRCm39) T76I probably benign Het
Zfp688 C A 7: 127,018,483 (GRCm39) C214F probably damaging Het
Zfp760 T C 17: 21,941,655 (GRCm39) S277P probably damaging Het
Other mutations in Rnf216
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02417:Rnf216 APN 5 143,054,665 (GRCm39) missense possibly damaging 0.67
IGL02502:Rnf216 APN 5 143,054,622 (GRCm39) missense probably damaging 1.00
IGL02536:Rnf216 APN 5 143,065,995 (GRCm39) missense probably benign 0.04
IGL03196:Rnf216 APN 5 143,066,766 (GRCm39) missense probably damaging 1.00
PIT4445001:Rnf216 UTSW 5 143,071,758 (GRCm39) missense probably damaging 1.00
R0270:Rnf216 UTSW 5 143,065,996 (GRCm39) missense possibly damaging 0.63
R0422:Rnf216 UTSW 5 143,076,125 (GRCm39) missense probably benign 0.15
R0422:Rnf216 UTSW 5 143,001,409 (GRCm39) nonsense probably null
R0782:Rnf216 UTSW 5 143,054,647 (GRCm39) missense possibly damaging 0.64
R1109:Rnf216 UTSW 5 143,054,124 (GRCm39) missense probably damaging 1.00
R1917:Rnf216 UTSW 5 142,978,561 (GRCm39) missense probably benign 0.03
R2233:Rnf216 UTSW 5 143,076,681 (GRCm39) missense probably benign
R2234:Rnf216 UTSW 5 143,076,681 (GRCm39) missense probably benign
R2235:Rnf216 UTSW 5 143,076,681 (GRCm39) missense probably benign
R2340:Rnf216 UTSW 5 143,066,089 (GRCm39) missense probably damaging 0.99
R3015:Rnf216 UTSW 5 143,061,480 (GRCm39) critical splice donor site probably null
R3726:Rnf216 UTSW 5 143,013,701 (GRCm39) missense probably damaging 0.96
R4231:Rnf216 UTSW 5 143,078,845 (GRCm39) missense probably damaging 1.00
R4885:Rnf216 UTSW 5 143,076,335 (GRCm39) nonsense probably null
R4942:Rnf216 UTSW 5 143,078,814 (GRCm39) missense probably damaging 1.00
R4973:Rnf216 UTSW 5 143,076,071 (GRCm39) missense probably benign
R5291:Rnf216 UTSW 5 143,075,967 (GRCm39) missense probably benign
R5307:Rnf216 UTSW 5 143,078,757 (GRCm39) missense probably damaging 1.00
R5328:Rnf216 UTSW 5 143,078,754 (GRCm39) missense possibly damaging 0.84
R5416:Rnf216 UTSW 5 143,001,526 (GRCm39) nonsense probably null
R5888:Rnf216 UTSW 5 143,054,069 (GRCm39) splice site probably null
R6048:Rnf216 UTSW 5 143,054,659 (GRCm39) missense probably damaging 1.00
R6451:Rnf216 UTSW 5 142,978,589 (GRCm39) missense possibly damaging 0.80
R6595:Rnf216 UTSW 5 143,076,412 (GRCm39) missense probably benign 0.00
R7422:Rnf216 UTSW 5 143,076,591 (GRCm39) missense probably benign 0.01
R7470:Rnf216 UTSW 5 142,978,480 (GRCm39) missense possibly damaging 0.88
R7507:Rnf216 UTSW 5 143,075,557 (GRCm39) missense probably damaging 1.00
R7695:Rnf216 UTSW 5 143,071,659 (GRCm39) missense possibly damaging 0.80
R7757:Rnf216 UTSW 5 143,065,991 (GRCm39) missense probably damaging 1.00
R7768:Rnf216 UTSW 5 143,084,199 (GRCm39) start codon destroyed probably null 1.00
R8056:Rnf216 UTSW 5 142,978,616 (GRCm39) missense probably benign 0.02
R8081:Rnf216 UTSW 5 143,013,719 (GRCm39) missense probably damaging 0.98
R8985:Rnf216 UTSW 5 143,076,180 (GRCm39) missense probably benign 0.16
Z1176:Rnf216 UTSW 5 143,084,198 (GRCm39) start codon destroyed probably null 0.99
Z1177:Rnf216 UTSW 5 142,978,562 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CACTTCTCTAACTGTGACCAGC -3'
(R):5'- AGATGAGACCTCACTTCTTGGG -3'

Sequencing Primer
(F):5'- AGCCCTGTGGAGCTAGATATATG -3'
(R):5'- CTCACTTCTTGGGGATGGG -3'
Posted On 2019-10-17