Mutagenetix > Incidental Mutation

Incidental Mutation 'R7504:Fancd2'

581667

Institutional Source

Beutler Lab

Gene Symbol

Fancd2

Ensembl Gene

ENSMUSG00000034023

Gene Name

Fanconi anemia, complementation group D2

Synonyms

2410150O07Rik

MMRRC Submission

045577-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7504 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

113531682-113597017 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 113545038 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 198 (I198N)

Ref Sequence

ENSEMBL: ENSMUSP00000045667 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036340] [ENSMUST00000204827]

AlphaFold

Q80V62

PDB Structure

Structure of the FANCI-FANCD2 complex [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000036340
AA Change: I198N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000045667
Gene: ENSMUSG00000034023
AA Change: I198N

Domain	Start	End	E-Value	Type
Pfam:FancD2	1	1415	N/A	PFAM
low complexity region	1430	1450	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000204827
AA Change: I198N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000144928
Gene: ENSMUSG00000034023
AA Change: I198N

Domain	Start	End	E-Value	Type
Pfam:FancD2	1	1402	N/A	PFAM
low complexity region	1417	1437	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group D2. This protein is monoubiquinated in response to DNA damage, resulting in its localization to nuclear foci with other proteins (BRCA1 AND BRCA2) involved in homology-directed DNA repair. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutant mice exhibit defects observed in human patients with Fanconi anemia (FA) meiotic defects and germ cell loss. In addition, mutant mice display perinatal lethality, susceptiblity ot epithelial cancer, and microphthalmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012H06Rik	C	G	17: 14,943,653	A14G	probably damaging	Het
6430573F11Rik	A	C	8: 36,512,155	N304T	probably benign	Het
Btn1a1	A	T	13: 23,461,716	M161K	probably benign	Het
Camkk2	G	A	5: 122,746,308	T350I	probably damaging	Het
Cdc42bpg	C	A	19: 6,306,784	D23E	possibly damaging	Het
Cdkn1a	T	C	17: 29,098,514	L36P	probably damaging	Het
Dek	A	G	13: 47,088,035	I351T	probably damaging	Het
Dst	T	C	1: 34,201,017	Y1816H	probably damaging	Het
Efl1	T	A	7: 82,683,049	N300K	probably damaging	Het
Ephx2	A	G	14: 66,101,617	Y294H	probably damaging	Het
Gm6502	G	T	5: 94,317,047	V431L	probably benign	Het
Grid1	G	T	14: 35,562,513	A738S	probably damaging	Het
Gsx2	G	A	5: 75,076,399		probably null	Het
Hc	G	A	2: 35,061,319	T22I	not run	Het
Hps1	T	C	19: 42,766,720	D261G	probably benign	Het
Ift80	T	C	3: 68,918,005	Y539C	probably damaging	Het
Insc	G	T	7: 114,791,298		probably null	Het
Isg15	T	C	4: 156,200,045	M9V	probably damaging	Het
Kalrn	A	G	16: 34,256,233	L695P	unknown	Het
Nars	A	C	18: 64,512,022	F52V	probably benign	Het
Nmt1	T	G	11: 103,056,459	F225V	probably damaging	Het
Olfr1352	A	G	10: 78,984,660	Y290C	possibly damaging	Het
Olfr143	A	T	9: 38,254,243	K272N	possibly damaging	Het
Olfr1495	T	A	19: 13,768,732	I130N	probably damaging	Het
Pbx3	T	C	2: 34,175,924	T385A	probably damaging	Het
Pcdhb11	A	T	18: 37,421,799	T61S	probably benign	Het
Rab11fip1	T	C	8: 27,152,953	E606G	possibly damaging	Het
Rnf216	A	G	5: 143,075,759	Y589H	probably benign	Het
Scara3	A	G	14: 65,931,331	I279T	possibly damaging	Het
Sdk2	T	A	11: 113,867,967	Y477F	possibly damaging	Het
Secisbp2l	T	C	2: 125,758,171	K415E	probably benign	Het
Stag1	C	T	9: 100,888,328	T639I	probably benign	Het
Sv2b	A	T	7: 75,136,383	F430I	probably benign	Het
Tenm2	C	T	11: 36,139,743	C743Y	probably damaging	Het
Tet2	C	A	3: 133,487,339	V445L	probably benign	Het
Tmem132c	T	C	5: 127,554,632	S652P	probably damaging	Het
Togaram1	A	G	12: 64,992,617	D1155G	possibly damaging	Het
Traip	T	C	9: 107,961,544	I169T	probably benign	Het
Usp45	T	G	4: 21,816,892	M374R	possibly damaging	Het
Vmn2r81	A	T	10: 79,268,332	H263L	probably benign	Het
Wdr95	T	C	5: 149,581,846	V364A	probably damaging	Het
Zfp128	G	A	7: 12,890,478	D258N	probably damaging	Het
Zfp335	G	A	2: 164,909,418	T76I	probably benign	Het
Zfp688	C	A	7: 127,419,311	C214F	probably damaging	Het
Zfp760	T	C	17: 21,722,674	S277P	probably damaging	Het

Other mutations in Fancd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Fancd2	APN	6	113564396	critical splice donor site	probably null
IGL00475:Fancd2	APN	6	113568610	missense	probably benign	0.01
IGL01319:Fancd2	APN	6	113584899	missense	probably damaging	0.98
IGL01339:Fancd2	APN	6	113553752	missense	probably benign	0.00
IGL01373:Fancd2	APN	6	113553752	missense	probably benign	0.00
IGL01393:Fancd2	APN	6	113577360	splice site	probably benign
IGL01630:Fancd2	APN	6	113563124	missense	probably damaging	1.00
IGL01769:Fancd2	APN	6	113545111	missense	possibly damaging	0.90
IGL01882:Fancd2	APN	6	113546640	missense	probably benign	0.05
IGL02029:Fancd2	APN	6	113570975	missense	probably benign	0.44
IGL02224:Fancd2	APN	6	113568320	critical splice donor site	probably null
IGL02271:Fancd2	APN	6	113535759	splice site	probably benign
IGL02352:Fancd2	APN	6	113563112	missense	probably damaging	1.00
IGL02359:Fancd2	APN	6	113563112	missense	probably damaging	1.00
IGL02427:Fancd2	APN	6	113549352	splice site	probably null
IGL02512:Fancd2	APN	6	113570943	missense	probably damaging	1.00
IGL02530:Fancd2	APN	6	113562461	missense	probably damaging	1.00
IGL02801:Fancd2	APN	6	113593317	missense	probably benign	0.00
IGL03090:Fancd2	APN	6	113537597	splice site	probably null
IGL03247:Fancd2	APN	6	113568208	missense	probably benign	0.03
R0278:Fancd2	UTSW	6	113548448	critical splice donor site	probably null
R0401:Fancd2	UTSW	6	113548343	missense	possibly damaging	0.46
R0420:Fancd2	UTSW	6	113536979	missense	probably damaging	0.98
R0496:Fancd2	UTSW	6	113555130	splice site	probably benign
R0762:Fancd2	UTSW	6	113574658	missense	probably benign	0.20
R0827:Fancd2	UTSW	6	113586249	critical splice donor site	probably null
R1225:Fancd2	UTSW	6	113535861	missense	probably damaging	0.99
R1576:Fancd2	UTSW	6	113578405	missense	probably damaging	0.98
R2010:Fancd2	UTSW	6	113593291	missense	probably damaging	0.96
R2079:Fancd2	UTSW	6	113555187	missense	probably damaging	1.00
R2118:Fancd2	UTSW	6	113560074	splice site	probably benign
R2141:Fancd2	UTSW	6	113549321	missense	probably benign	0.00
R2168:Fancd2	UTSW	6	113591159	missense	possibly damaging	0.92
R2180:Fancd2	UTSW	6	113574637	missense	probably benign	0.33
R3016:Fancd2	UTSW	6	113536726	missense	probably benign	0.00
R3153:Fancd2	UTSW	6	113593269	missense	possibly damaging	0.55
R3154:Fancd2	UTSW	6	113593269	missense	possibly damaging	0.55
R3783:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R3786:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R3787:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R4379:Fancd2	UTSW	6	113561716	missense	probably benign	0.00
R4388:Fancd2	UTSW	6	113556368	missense	probably damaging	0.99
R4544:Fancd2	UTSW	6	113572642	critical splice acceptor site	probably null
R4598:Fancd2	UTSW	6	113585477	missense	probably benign	0.06
R4832:Fancd2	UTSW	6	113553722	missense	probably benign	0.16
R4841:Fancd2	UTSW	6	113562430	missense	probably damaging	1.00
R4922:Fancd2	UTSW	6	113585473	missense	probably benign	0.03
R5375:Fancd2	UTSW	6	113568712	missense	possibly damaging	0.93
R5579:Fancd2	UTSW	6	113560051	critical splice acceptor site	probably null
R5782:Fancd2	UTSW	6	113548872	missense	probably benign	0.00
R5871:Fancd2	UTSW	6	113556282	missense	probably benign	0.30
R5901:Fancd2	UTSW	6	113549365	missense	probably damaging	1.00
R5909:Fancd2	UTSW	6	113561711	missense	probably benign
R6026:Fancd2	UTSW	6	113551770	missense	possibly damaging	0.46
R6166:Fancd2	UTSW	6	113555251	missense	possibly damaging	0.67
R6393:Fancd2	UTSW	6	113578413	missense	probably benign	0.01
R6666:Fancd2	UTSW	6	113585509	missense	probably damaging	0.96
R6669:Fancd2	UTSW	6	113593327	missense	probably benign	0.00
R6676:Fancd2	UTSW	6	113537665	nonsense	probably null
R6762:Fancd2	UTSW	6	113586016	splice site	probably null
R6911:Fancd2	UTSW	6	113548385	missense	probably damaging	0.98
R6992:Fancd2	UTSW	6	113571018	critical splice donor site	probably null
R7091:Fancd2	UTSW	6	113545101	missense	probably damaging	1.00
R7252:Fancd2	UTSW	6	113556285	missense	probably damaging	0.98
R7343:Fancd2	UTSW	6	113536939	missense	probably benign	0.01
R7344:Fancd2	UTSW	6	113568709	missense	probably benign	0.09
R7354:Fancd2	UTSW	6	113595946	missense	unknown
R7489:Fancd2	UTSW	6	113564304	missense	probably benign
R7501:Fancd2	UTSW	6	113548403	missense	possibly damaging	0.95
R7992:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R8027:Fancd2	UTSW	6	113546622	missense	probably damaging	1.00
R8487:Fancd2	UTSW	6	113568226	missense	probably damaging	1.00
R8509:Fancd2	UTSW	6	113572570	missense	probably benign	0.00
R8757:Fancd2	UTSW	6	113560093	missense	possibly damaging	0.91
R8960:Fancd2	UTSW	6	113563168	critical splice donor site	probably null
R8978:Fancd2	UTSW	6	113585546	splice site	probably benign
R9110:Fancd2	UTSW	6	113535801	missense	possibly damaging	0.94
R9116:Fancd2	UTSW	6	113555219	missense	probably benign	0.00
R9490:Fancd2	UTSW	6	113578455	missense	probably damaging	0.98
R9667:Fancd2	UTSW	6	113553756	nonsense	probably null
Z1088:Fancd2	UTSW	6	113581422	missense	probably benign	0.00
Z1177:Fancd2	UTSW	6	113545025	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTGCCAGTGCTTCCCAGG -3'
(R):5'- GGCAAGTCAGTTCTCTTCTACTA -3'

Sequencing Primer
(F):5'- AGTGCTTCCCAGGAGTCTAC -3'
(R):5'- GGTAAGCCCCTTTAGCCAGAGTTAC -3'

Posted On

2019-10-17