Incidental Mutation 'R7504:Fancd2'
ID581667
Institutional Source Beutler Lab
Gene Symbol Fancd2
Ensembl Gene ENSMUSG00000034023
Gene NameFanconi anemia, complementation group D2
Synonyms2410150O07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7504 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location113531682-113597017 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 113545038 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 198 (I198N)
Ref Sequence ENSEMBL: ENSMUSP00000045667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036340] [ENSMUST00000204827]
PDB Structure Structure of the FANCI-FANCD2 complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000036340
AA Change: I198N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000045667
Gene: ENSMUSG00000034023
AA Change: I198N

DomainStartEndE-ValueType
Pfam:FancD2 1 1415 N/A PFAM
low complexity region 1430 1450 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204827
AA Change: I198N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144928
Gene: ENSMUSG00000034023
AA Change: I198N

DomainStartEndE-ValueType
Pfam:FancD2 1 1402 N/A PFAM
low complexity region 1417 1437 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group D2. This protein is monoubiquinated in response to DNA damage, resulting in its localization to nuclear foci with other proteins (BRCA1 AND BRCA2) involved in homology-directed DNA repair. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutant mice exhibit defects observed in human patients with Fanconi anemia (FA) meiotic defects and germ cell loss. In addition, mutant mice display perinatal lethality, susceptiblity ot epithelial cancer, and microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C G 17: 14,943,653 A14G probably damaging Het
6430573F11Rik A C 8: 36,512,155 N304T probably benign Het
Btn1a1 A T 13: 23,461,716 M161K probably benign Het
Camkk2 G A 5: 122,746,308 T350I probably damaging Het
Cdc42bpg C A 19: 6,306,784 D23E possibly damaging Het
Cdkn1a T C 17: 29,098,514 L36P probably damaging Het
Dek A G 13: 47,088,035 I351T probably damaging Het
Dst T C 1: 34,201,017 Y1816H probably damaging Het
Efl1 T A 7: 82,683,049 N300K probably damaging Het
Ephx2 A G 14: 66,101,617 Y294H probably damaging Het
Gm6502 G T 5: 94,317,047 V431L probably benign Het
Grid1 G T 14: 35,562,513 A738S probably damaging Het
Gsx2 G A 5: 75,076,399 probably null Het
Hc G A 2: 35,061,319 T22I not run Het
Hps1 T C 19: 42,766,720 D261G probably benign Het
Ift80 T C 3: 68,918,005 Y539C probably damaging Het
Insc G T 7: 114,791,298 probably null Het
Isg15 T C 4: 156,200,045 M9V probably damaging Het
Kalrn A G 16: 34,256,233 L695P unknown Het
Nars A C 18: 64,512,022 F52V probably benign Het
Nmt1 T G 11: 103,056,459 F225V probably damaging Het
Olfr1352 A G 10: 78,984,660 Y290C possibly damaging Het
Olfr143 A T 9: 38,254,243 K272N possibly damaging Het
Olfr1495 T A 19: 13,768,732 I130N probably damaging Het
Pbx3 T C 2: 34,175,924 T385A probably damaging Het
Pcdhb11 A T 18: 37,421,799 T61S probably benign Het
Rab11fip1 T C 8: 27,152,953 E606G possibly damaging Het
Rnf216 A G 5: 143,075,759 Y589H probably benign Het
Scara3 A G 14: 65,931,331 I279T possibly damaging Het
Sdk2 T A 11: 113,867,967 Y477F possibly damaging Het
Secisbp2l T C 2: 125,758,171 K415E probably benign Het
Stag1 C T 9: 100,888,328 T639I probably benign Het
Sv2b A T 7: 75,136,383 F430I probably benign Het
Tenm2 C T 11: 36,139,743 C743Y probably damaging Het
Tet2 C A 3: 133,487,339 V445L probably benign Het
Tmem132c T C 5: 127,554,632 S652P probably damaging Het
Togaram1 A G 12: 64,992,617 D1155G possibly damaging Het
Traip T C 9: 107,961,544 I169T probably benign Het
Usp45 T G 4: 21,816,892 M374R possibly damaging Het
Vmn2r81 A T 10: 79,268,332 H263L probably benign Het
Wdr95 T C 5: 149,581,846 V364A probably damaging Het
Zfp128 G A 7: 12,890,478 D258N probably damaging Het
Zfp335 G A 2: 164,909,418 T76I probably benign Het
Zfp688 C A 7: 127,419,311 C214F probably damaging Het
Zfp760 T C 17: 21,722,674 S277P probably damaging Het
Other mutations in Fancd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Fancd2 APN 6 113564396 critical splice donor site probably null
IGL00475:Fancd2 APN 6 113568610 missense probably benign 0.01
IGL01319:Fancd2 APN 6 113584899 missense probably damaging 0.98
IGL01339:Fancd2 APN 6 113553752 missense probably benign 0.00
IGL01373:Fancd2 APN 6 113553752 missense probably benign 0.00
IGL01393:Fancd2 APN 6 113577360 splice site probably benign
IGL01630:Fancd2 APN 6 113563124 missense probably damaging 1.00
IGL01769:Fancd2 APN 6 113545111 missense possibly damaging 0.90
IGL01882:Fancd2 APN 6 113546640 missense probably benign 0.05
IGL02029:Fancd2 APN 6 113570975 missense probably benign 0.44
IGL02224:Fancd2 APN 6 113568320 critical splice donor site probably null
IGL02271:Fancd2 APN 6 113535759 splice site probably benign
IGL02352:Fancd2 APN 6 113563112 missense probably damaging 1.00
IGL02359:Fancd2 APN 6 113563112 missense probably damaging 1.00
IGL02427:Fancd2 APN 6 113549352 splice site probably null
IGL02512:Fancd2 APN 6 113570943 missense probably damaging 1.00
IGL02530:Fancd2 APN 6 113562461 missense probably damaging 1.00
IGL02801:Fancd2 APN 6 113593317 missense probably benign 0.00
IGL03090:Fancd2 APN 6 113537597 splice site probably null
IGL03247:Fancd2 APN 6 113568208 missense probably benign 0.03
R0278:Fancd2 UTSW 6 113548448 critical splice donor site probably null
R0401:Fancd2 UTSW 6 113548343 missense possibly damaging 0.46
R0420:Fancd2 UTSW 6 113536979 missense probably damaging 0.98
R0496:Fancd2 UTSW 6 113555130 splice site probably benign
R0762:Fancd2 UTSW 6 113574658 missense probably benign 0.20
R0827:Fancd2 UTSW 6 113586249 critical splice donor site probably null
R1225:Fancd2 UTSW 6 113535861 missense probably damaging 0.99
R1576:Fancd2 UTSW 6 113578405 missense probably damaging 0.98
R2010:Fancd2 UTSW 6 113593291 missense probably damaging 0.96
R2079:Fancd2 UTSW 6 113555187 missense probably damaging 1.00
R2118:Fancd2 UTSW 6 113560074 splice site probably benign
R2141:Fancd2 UTSW 6 113549321 missense probably benign 0.00
R2168:Fancd2 UTSW 6 113591159 missense possibly damaging 0.92
R2180:Fancd2 UTSW 6 113574637 missense probably benign 0.33
R3016:Fancd2 UTSW 6 113536726 missense probably benign 0.00
R3153:Fancd2 UTSW 6 113593269 missense possibly damaging 0.55
R3154:Fancd2 UTSW 6 113593269 missense possibly damaging 0.55
R3783:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R3786:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R3787:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R4379:Fancd2 UTSW 6 113561716 missense probably benign 0.00
R4388:Fancd2 UTSW 6 113556368 missense probably damaging 0.99
R4544:Fancd2 UTSW 6 113572642 critical splice acceptor site probably null
R4598:Fancd2 UTSW 6 113585477 missense probably benign 0.06
R4832:Fancd2 UTSW 6 113553722 missense probably benign 0.16
R4841:Fancd2 UTSW 6 113562430 missense probably damaging 1.00
R4922:Fancd2 UTSW 6 113585473 missense probably benign 0.03
R5375:Fancd2 UTSW 6 113568712 missense possibly damaging 0.93
R5579:Fancd2 UTSW 6 113560051 critical splice acceptor site probably null
R5782:Fancd2 UTSW 6 113548872 missense probably benign 0.00
R5871:Fancd2 UTSW 6 113556282 missense probably benign 0.30
R5901:Fancd2 UTSW 6 113549365 missense probably damaging 1.00
R5909:Fancd2 UTSW 6 113561711 missense probably benign
R6026:Fancd2 UTSW 6 113551770 missense possibly damaging 0.46
R6166:Fancd2 UTSW 6 113555251 missense possibly damaging 0.67
R6393:Fancd2 UTSW 6 113578413 missense probably benign 0.01
R6666:Fancd2 UTSW 6 113585509 missense probably damaging 0.96
R6669:Fancd2 UTSW 6 113593327 missense probably benign 0.00
R6676:Fancd2 UTSW 6 113537665 nonsense probably null
R6762:Fancd2 UTSW 6 113586016 splice site probably null
R6911:Fancd2 UTSW 6 113548385 missense probably damaging 0.98
R6992:Fancd2 UTSW 6 113571018 critical splice donor site probably null
R7091:Fancd2 UTSW 6 113545101 missense probably damaging 1.00
R7252:Fancd2 UTSW 6 113556285 missense probably damaging 0.98
R7343:Fancd2 UTSW 6 113536939 missense probably benign 0.01
R7344:Fancd2 UTSW 6 113568709 missense probably benign 0.09
R7354:Fancd2 UTSW 6 113595946 missense unknown
R7489:Fancd2 UTSW 6 113564304 missense probably benign
R7501:Fancd2 UTSW 6 113548403 missense possibly damaging 0.95
R7992:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R8027:Fancd2 UTSW 6 113546622 missense probably damaging 1.00
R8487:Fancd2 UTSW 6 113568226 missense probably damaging 1.00
R8509:Fancd2 UTSW 6 113572570 missense probably benign 0.00
R8757:Fancd2 UTSW 6 113560093 missense possibly damaging 0.91
Z1088:Fancd2 UTSW 6 113581422 missense probably benign 0.00
Z1177:Fancd2 UTSW 6 113545025 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGCCAGTGCTTCCCAGG -3'
(R):5'- GGCAAGTCAGTTCTCTTCTACTA -3'

Sequencing Primer
(F):5'- AGTGCTTCCCAGGAGTCTAC -3'
(R):5'- GGTAAGCCCCTTTAGCCAGAGTTAC -3'
Posted On2019-10-17