Incidental Mutation 'R7504:Zfp128'
ID581668
Institutional Source Beutler Lab
Gene Symbol Zfp128
Ensembl Gene ENSMUSG00000060397
Gene Namezinc finger protein 128
SynonymsmZnf8, 9630016P15Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R7504 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location12881177-12893422 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12890478 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 258 (D258N)
Ref Sequence ENSEMBL: ENSMUSP00000115378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000144578]
Predicted Effect probably damaging
Transcript: ENSMUST00000144578
AA Change: D258N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115378
Gene: ENSMUSG00000060397
AA Change: D258N

DomainStartEndE-ValueType
KRAB 25 85 2.51e-38 SMART
ZnF_C2H2 254 276 8.47e-4 SMART
ZnF_C2H2 282 304 5.21e-4 SMART
ZnF_C2H2 310 332 4.17e-3 SMART
ZnF_C2H2 338 360 3.89e-3 SMART
ZnF_C2H2 366 388 1.47e-3 SMART
ZnF_C2H2 394 416 8.47e-4 SMART
ZnF_C2H2 464 486 3.39e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C G 17: 14,943,653 A14G probably damaging Het
6430573F11Rik A C 8: 36,512,155 N304T probably benign Het
Btn1a1 A T 13: 23,461,716 M161K probably benign Het
Camkk2 G A 5: 122,746,308 T350I probably damaging Het
Cdc42bpg C A 19: 6,306,784 D23E possibly damaging Het
Cdkn1a T C 17: 29,098,514 L36P probably damaging Het
Dek A G 13: 47,088,035 I351T probably damaging Het
Dst T C 1: 34,201,017 Y1816H probably damaging Het
Efl1 T A 7: 82,683,049 N300K probably damaging Het
Ephx2 A G 14: 66,101,617 Y294H probably damaging Het
Fancd2 T A 6: 113,545,038 I198N probably damaging Het
Gm6502 G T 5: 94,317,047 V431L probably benign Het
Grid1 G T 14: 35,562,513 A738S probably damaging Het
Gsx2 G A 5: 75,076,399 probably null Het
Hc G A 2: 35,061,319 T22I not run Het
Hps1 T C 19: 42,766,720 D261G probably benign Het
Ift80 T C 3: 68,918,005 Y539C probably damaging Het
Insc G T 7: 114,791,298 probably null Het
Isg15 T C 4: 156,200,045 M9V probably damaging Het
Kalrn A G 16: 34,256,233 L695P unknown Het
Nars A C 18: 64,512,022 F52V probably benign Het
Nmt1 T G 11: 103,056,459 F225V probably damaging Het
Olfr1352 A G 10: 78,984,660 Y290C possibly damaging Het
Olfr143 A T 9: 38,254,243 K272N possibly damaging Het
Olfr1495 T A 19: 13,768,732 I130N probably damaging Het
Pbx3 T C 2: 34,175,924 T385A probably damaging Het
Pcdhb11 A T 18: 37,421,799 T61S probably benign Het
Rab11fip1 T C 8: 27,152,953 E606G possibly damaging Het
Rnf216 A G 5: 143,075,759 Y589H probably benign Het
Scara3 A G 14: 65,931,331 I279T possibly damaging Het
Sdk2 T A 11: 113,867,967 Y477F possibly damaging Het
Secisbp2l T C 2: 125,758,171 K415E probably benign Het
Stag1 C T 9: 100,888,328 T639I probably benign Het
Sv2b A T 7: 75,136,383 F430I probably benign Het
Tenm2 C T 11: 36,139,743 C743Y probably damaging Het
Tet2 C A 3: 133,487,339 V445L probably benign Het
Tmem132c T C 5: 127,554,632 S652P probably damaging Het
Togaram1 A G 12: 64,992,617 D1155G possibly damaging Het
Traip T C 9: 107,961,544 I169T probably benign Het
Usp45 T G 4: 21,816,892 M374R possibly damaging Het
Vmn2r81 A T 10: 79,268,332 H263L probably benign Het
Wdr95 T C 5: 149,581,846 V364A probably damaging Het
Zfp335 G A 2: 164,909,418 T76I probably benign Het
Zfp688 C A 7: 127,419,311 C214F probably damaging Het
Zfp760 T C 17: 21,722,674 S277P probably damaging Het
Other mutations in Zfp128
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Zfp128 APN 7 12891022 missense probably benign 0.00
IGL01293:Zfp128 APN 7 12891424 makesense probably null
IGL02067:Zfp128 APN 7 12885050 missense possibly damaging 0.86
IGL02146:Zfp128 APN 7 12890032 missense possibly damaging 0.72
IGL02654:Zfp128 APN 7 12884679 missense possibly damaging 0.95
IGL03066:Zfp128 APN 7 12890117 missense probably benign 0.00
IGL03076:Zfp128 APN 7 12884709 missense possibly damaging 0.95
IGL03113:Zfp128 APN 7 12890387 missense probably benign 0.00
IGL03237:Zfp128 APN 7 12891026 missense probably benign 0.28
R0783:Zfp128 UTSW 7 12890272 missense probably damaging 1.00
R1686:Zfp128 UTSW 7 12890636 nonsense probably null
R1806:Zfp128 UTSW 7 12891022 missense probably benign 0.00
R2021:Zfp128 UTSW 7 12890029 missense possibly damaging 0.96
R3792:Zfp128 UTSW 7 12884732 missense probably damaging 0.98
R4105:Zfp128 UTSW 7 12884740 missense probably damaging 0.99
R4167:Zfp128 UTSW 7 12890362 missense probably benign 0.28
R4168:Zfp128 UTSW 7 12890362 missense probably benign 0.28
R5743:Zfp128 UTSW 7 12884727 missense probably damaging 1.00
R6266:Zfp128 UTSW 7 12890970 missense possibly damaging 0.80
R6799:Zfp128 UTSW 7 12890899 missense possibly damaging 0.93
R7102:Zfp128 UTSW 7 12890472 missense probably damaging 1.00
R7313:Zfp128 UTSW 7 12890534 missense possibly damaging 0.94
R7428:Zfp128 UTSW 7 12890362 missense probably benign 0.28
R7539:Zfp128 UTSW 7 12890552 nonsense probably null
R7636:Zfp128 UTSW 7 12890112 missense probably benign
R7755:Zfp128 UTSW 7 12890313 nonsense probably null
R7820:Zfp128 UTSW 7 12891022 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGGAAGAGAGTATGGCTGTAC -3'
(R):5'- AATTCTGATTGAAGGCCCTCC -3'

Sequencing Primer
(F):5'- GAGTATGGCTGTACTTATGACTCAC -3'
(R):5'- CCAGTGTGAATTCTCCTATGGACTG -3'
Posted On2019-10-17