Incidental Mutation 'R7504:Efl1'
ID 581670
Institutional Source Beutler Lab
Gene Symbol Efl1
Ensembl Gene ENSMUSG00000038563
Gene Name elongation factor like GTPase 1
Synonyms D7Ertd791e, 6030468D11Rik, 4932434J20Rik, Eftud1
MMRRC Submission 045577-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.870) question?
Stock # R7504 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 82297822-82427060 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 82332257 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 300 (N300K)
Ref Sequence ENSEMBL: ENSMUSP00000046046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000179489]
AlphaFold Q8C0D5
Predicted Effect probably damaging
Transcript: ENSMUST00000039881
AA Change: N300K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563
AA Change: N300K

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 365 7.4e-62 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:EFG_II 614 687 4.3e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179489
AA Change: N300K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563
AA Change: N300K

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 364 8.7e-58 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:GTP_EFTU_D2 504 599 1e-7 PFAM
Pfam:EFG_II 614 687 1.8e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C G 17: 15,163,915 (GRCm39) A14G probably damaging Het
Btn1a1 A T 13: 23,645,886 (GRCm39) M161K probably benign Het
Camkk2 G A 5: 122,884,371 (GRCm39) T350I probably damaging Het
Cdc42bpg C A 19: 6,356,814 (GRCm39) D23E possibly damaging Het
Cdkn1a T C 17: 29,317,488 (GRCm39) L36P probably damaging Het
Dek A G 13: 47,241,511 (GRCm39) I351T probably damaging Het
Dst T C 1: 34,240,098 (GRCm39) Y1816H probably damaging Het
Ephx2 A G 14: 66,339,066 (GRCm39) Y294H probably damaging Het
Fancd2 T A 6: 113,521,999 (GRCm39) I198N probably damaging Het
Grid1 G T 14: 35,284,470 (GRCm39) A738S probably damaging Het
Gsx2 G A 5: 75,237,060 (GRCm39) probably null Het
Hc G A 2: 34,951,331 (GRCm39) T22I not run Het
Hps1 T C 19: 42,755,159 (GRCm39) D261G probably benign Het
Ift80 T C 3: 68,825,338 (GRCm39) Y539C probably damaging Het
Insc G T 7: 114,390,533 (GRCm39) probably null Het
Isg15 T C 4: 156,284,502 (GRCm39) M9V probably damaging Het
Kalrn A G 16: 34,076,603 (GRCm39) L695P unknown Het
Nars1 A C 18: 64,645,093 (GRCm39) F52V probably benign Het
Nmt1 T G 11: 102,947,285 (GRCm39) F225V probably damaging Het
Or10q12 T A 19: 13,746,096 (GRCm39) I130N probably damaging Het
Or7a36 A G 10: 78,820,494 (GRCm39) Y290C possibly damaging Het
Or8c8 A T 9: 38,165,539 (GRCm39) K272N possibly damaging Het
Pbx3 T C 2: 34,065,936 (GRCm39) T385A probably damaging Het
Pcdhb11 A T 18: 37,554,852 (GRCm39) T61S probably benign Het
Pramel40 G T 5: 94,464,906 (GRCm39) V431L probably benign Het
Rab11fip1 T C 8: 27,642,981 (GRCm39) E606G possibly damaging Het
Rnf216 A G 5: 143,061,514 (GRCm39) Y589H probably benign Het
Scara3 A G 14: 66,168,780 (GRCm39) I279T possibly damaging Het
Sdk2 T A 11: 113,758,793 (GRCm39) Y477F possibly damaging Het
Secisbp2l T C 2: 125,600,091 (GRCm39) K415E probably benign Het
Stag1 C T 9: 100,770,381 (GRCm39) T639I probably benign Het
Sv2b A T 7: 74,786,131 (GRCm39) F430I probably benign Het
Tenm2 C T 11: 36,030,570 (GRCm39) C743Y probably damaging Het
Tet2 C A 3: 133,193,100 (GRCm39) V445L probably benign Het
Tmem132c T C 5: 127,631,696 (GRCm39) S652P probably damaging Het
Togaram1 A G 12: 65,039,391 (GRCm39) D1155G possibly damaging Het
Traip T C 9: 107,838,743 (GRCm39) I169T probably benign Het
Trmt9b A C 8: 36,979,309 (GRCm39) N304T probably benign Het
Usp45 T G 4: 21,816,892 (GRCm39) M374R possibly damaging Het
Vmn2r81 A T 10: 79,104,166 (GRCm39) H263L probably benign Het
Wdr95 T C 5: 149,505,311 (GRCm39) V364A probably damaging Het
Zfp128 G A 7: 12,624,405 (GRCm39) D258N probably damaging Het
Zfp335 G A 2: 164,751,338 (GRCm39) T76I probably benign Het
Zfp688 C A 7: 127,018,483 (GRCm39) C214F probably damaging Het
Zfp760 T C 17: 21,941,655 (GRCm39) S277P probably damaging Het
Other mutations in Efl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Efl1 APN 7 82,307,319 (GRCm39) missense probably damaging 1.00
IGL00696:Efl1 APN 7 82,301,080 (GRCm39) splice site probably benign
IGL01344:Efl1 APN 7 82,330,688 (GRCm39) splice site probably benign
IGL01871:Efl1 APN 7 82,412,527 (GRCm39) missense possibly damaging 0.64
IGL01941:Efl1 APN 7 82,347,184 (GRCm39) missense probably benign 0.17
IGL02104:Efl1 APN 7 82,307,263 (GRCm39) critical splice acceptor site probably null
IGL02150:Efl1 APN 7 82,335,899 (GRCm39) missense probably benign
IGL02484:Efl1 APN 7 82,332,247 (GRCm39) missense probably damaging 0.98
IGL03140:Efl1 APN 7 82,342,089 (GRCm39) missense probably benign 0.00
IGL03188:Efl1 APN 7 82,320,909 (GRCm39) missense probably damaging 1.00
IGL03014:Efl1 UTSW 7 82,301,094 (GRCm39) missense probably damaging 1.00
PIT4469001:Efl1 UTSW 7 82,307,373 (GRCm39) missense probably benign 0.14
R0148:Efl1 UTSW 7 82,320,878 (GRCm39) missense probably damaging 1.00
R0226:Efl1 UTSW 7 82,342,219 (GRCm39) splice site probably benign
R0638:Efl1 UTSW 7 82,301,095 (GRCm39) missense probably damaging 1.00
R0684:Efl1 UTSW 7 82,301,094 (GRCm39) missense probably damaging 1.00
R1018:Efl1 UTSW 7 82,412,221 (GRCm39) missense possibly damaging 0.94
R1290:Efl1 UTSW 7 82,320,936 (GRCm39) missense probably damaging 1.00
R1720:Efl1 UTSW 7 82,332,929 (GRCm39) missense possibly damaging 0.50
R1933:Efl1 UTSW 7 82,412,325 (GRCm39) nonsense probably null
R1973:Efl1 UTSW 7 82,412,085 (GRCm39) missense probably damaging 1.00
R2016:Efl1 UTSW 7 82,402,917 (GRCm39) missense probably damaging 1.00
R2124:Efl1 UTSW 7 82,342,121 (GRCm39) missense probably damaging 1.00
R2290:Efl1 UTSW 7 82,426,878 (GRCm39) missense probably damaging 1.00
R2415:Efl1 UTSW 7 82,347,175 (GRCm39) missense probably damaging 1.00
R3545:Efl1 UTSW 7 82,412,018 (GRCm39) missense probably benign 0.00
R3688:Efl1 UTSW 7 82,412,178 (GRCm39) missense probably benign 0.00
R4092:Efl1 UTSW 7 82,412,035 (GRCm39) missense probably benign 0.00
R4207:Efl1 UTSW 7 82,400,024 (GRCm39) missense probably damaging 0.98
R4347:Efl1 UTSW 7 82,347,174 (GRCm39) missense probably damaging 1.00
R4425:Efl1 UTSW 7 82,412,491 (GRCm39) missense probably damaging 0.99
R4816:Efl1 UTSW 7 82,320,927 (GRCm39) missense probably damaging 1.00
R4858:Efl1 UTSW 7 82,320,835 (GRCm39) missense probably damaging 1.00
R5077:Efl1 UTSW 7 82,307,295 (GRCm39) missense probably damaging 1.00
R5185:Efl1 UTSW 7 82,421,707 (GRCm39) missense probably damaging 1.00
R5319:Efl1 UTSW 7 82,323,714 (GRCm39) missense probably damaging 1.00
R5771:Efl1 UTSW 7 82,341,732 (GRCm39) missense probably benign 0.26
R5857:Efl1 UTSW 7 82,412,397 (GRCm39) missense probably benign
R5956:Efl1 UTSW 7 82,301,107 (GRCm39) missense probably damaging 1.00
R6433:Efl1 UTSW 7 82,323,776 (GRCm39) missense probably damaging 1.00
R7131:Efl1 UTSW 7 82,307,272 (GRCm39) missense probably damaging 1.00
R7143:Efl1 UTSW 7 82,411,888 (GRCm39) missense probably damaging 1.00
R7312:Efl1 UTSW 7 82,330,652 (GRCm39) missense probably benign 0.10
R7409:Efl1 UTSW 7 82,347,121 (GRCm39) missense probably damaging 0.98
R7422:Efl1 UTSW 7 82,330,587 (GRCm39) missense probably damaging 1.00
R7453:Efl1 UTSW 7 82,330,675 (GRCm39) missense possibly damaging 0.76
R7884:Efl1 UTSW 7 82,307,307 (GRCm39) missense probably damaging 1.00
R7969:Efl1 UTSW 7 82,342,178 (GRCm39) missense probably benign 0.03
R8394:Efl1 UTSW 7 82,411,986 (GRCm39) missense probably benign 0.00
R8702:Efl1 UTSW 7 82,399,998 (GRCm39) critical splice acceptor site probably null
R8924:Efl1 UTSW 7 82,412,161 (GRCm39) missense probably benign 0.03
R9463:Efl1 UTSW 7 82,426,733 (GRCm39) missense probably damaging 1.00
R9762:Efl1 UTSW 7 82,412,596 (GRCm39) missense probably benign 0.09
Z1088:Efl1 UTSW 7 82,342,058 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTCTGGCTCCTAGAGGAAGAG -3'
(R):5'- ACATTGTTCCCAAGCCCTAC -3'

Sequencing Primer
(F):5'- GATGGCTCATTGCTTATGACTTAC -3'
(R):5'- TACAACATCTGGGAAGCTCTAAG -3'
Posted On 2019-10-17