Incidental Mutation 'R7504:Insc'
ID581671
Institutional Source Beutler Lab
Gene Symbol Insc
Ensembl Gene ENSMUSG00000048782
Gene NameINSC spindle orientation adaptor protein
SynonymsInscuteable, 3830422K02Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R7504 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location114743694-114850383 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 114791298 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117543] [ENSMUST00000117543] [ENSMUST00000136645] [ENSMUST00000151464] [ENSMUST00000161800] [ENSMUST00000169913] [ENSMUST00000169913] [ENSMUST00000206274]
Predicted Effect probably null
Transcript: ENSMUST00000117543
SMART Domains Protein: ENSMUSP00000112682
Gene: ENSMUSG00000048782

DomainStartEndE-ValueType
Pfam:INSC_LBD 23 69 8.3e-34 PFAM
SCOP:d1jdha_ 151 497 6e-9 SMART
Blast:ARM 263 286 2e-7 BLAST
Blast:ARM 401 452 7e-21 BLAST
Blast:ARM 453 483 2e-7 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000117543
SMART Domains Protein: ENSMUSP00000112682
Gene: ENSMUSG00000048782

DomainStartEndE-ValueType
Pfam:INSC_LBD 23 69 8.3e-34 PFAM
SCOP:d1jdha_ 151 497 6e-9 SMART
Blast:ARM 263 286 2e-7 BLAST
Blast:ARM 401 452 7e-21 BLAST
Blast:ARM 453 483 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000136645
SMART Domains Protein: ENSMUSP00000119459
Gene: ENSMUSG00000048782

DomainStartEndE-ValueType
PDB:3SF4|F 20 59 1e-19 PDB
low complexity region 60 78 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151464
SMART Domains Protein: ENSMUSP00000117296
Gene: ENSMUSG00000048782

DomainStartEndE-ValueType
PDB:3SF4|F 20 53 8e-17 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000161800
SMART Domains Protein: ENSMUSP00000125061
Gene: ENSMUSG00000048782

DomainStartEndE-ValueType
PDB:3RO3|B 66 87 5e-9 PDB
Predicted Effect probably null
Transcript: ENSMUST00000169913
SMART Domains Protein: ENSMUSP00000129505
Gene: ENSMUSG00000048782

DomainStartEndE-ValueType
PDB:3SF4|F 20 59 1e-17 PDB
low complexity region 60 78 N/A INTRINSIC
SCOP:d1jdha_ 151 497 6e-9 SMART
Blast:ARM 263 286 2e-7 BLAST
Blast:ARM 401 452 7e-21 BLAST
Blast:ARM 453 483 2e-7 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000169913
SMART Domains Protein: ENSMUSP00000129505
Gene: ENSMUSG00000048782

DomainStartEndE-ValueType
PDB:3SF4|F 20 59 1e-17 PDB
low complexity region 60 78 N/A INTRINSIC
SCOP:d1jdha_ 151 497 6e-9 SMART
Blast:ARM 263 286 2e-7 BLAST
Blast:ARM 401 452 7e-21 BLAST
Blast:ARM 453 483 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000206274
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In Drosophila, neuroblasts divide asymmetrically into another neuroblast at the apical side and a smaller ganglion mother cell on the basal side. Cell polarization is precisely regulated by 2 apically localized multiprotein signaling complexes that are tethered by Inscuteable, which regulates their apical localization (Izaki et al., 2006 [PubMed 16458856]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to abnormal cochlear hair cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C G 17: 14,943,653 A14G probably damaging Het
6430573F11Rik A C 8: 36,512,155 N304T probably benign Het
Btn1a1 A T 13: 23,461,716 M161K probably benign Het
Camkk2 G A 5: 122,746,308 T350I probably damaging Het
Cdc42bpg C A 19: 6,306,784 D23E possibly damaging Het
Cdkn1a T C 17: 29,098,514 L36P probably damaging Het
Dek A G 13: 47,088,035 I351T probably damaging Het
Dst T C 1: 34,201,017 Y1816H probably damaging Het
Efl1 T A 7: 82,683,049 N300K probably damaging Het
Ephx2 A G 14: 66,101,617 Y294H probably damaging Het
Fancd2 T A 6: 113,545,038 I198N probably damaging Het
Gm6502 G T 5: 94,317,047 V431L probably benign Het
Grid1 G T 14: 35,562,513 A738S probably damaging Het
Gsx2 G A 5: 75,076,399 probably null Het
Hc G A 2: 35,061,319 T22I not run Het
Hps1 T C 19: 42,766,720 D261G probably benign Het
Ift80 T C 3: 68,918,005 Y539C probably damaging Het
Isg15 T C 4: 156,200,045 M9V probably damaging Het
Kalrn A G 16: 34,256,233 L695P unknown Het
Nars A C 18: 64,512,022 F52V probably benign Het
Nmt1 T G 11: 103,056,459 F225V probably damaging Het
Olfr1352 A G 10: 78,984,660 Y290C possibly damaging Het
Olfr143 A T 9: 38,254,243 K272N possibly damaging Het
Olfr1495 T A 19: 13,768,732 I130N probably damaging Het
Pbx3 T C 2: 34,175,924 T385A probably damaging Het
Pcdhb11 A T 18: 37,421,799 T61S probably benign Het
Rab11fip1 T C 8: 27,152,953 E606G possibly damaging Het
Rnf216 A G 5: 143,075,759 Y589H probably benign Het
Scara3 A G 14: 65,931,331 I279T possibly damaging Het
Sdk2 T A 11: 113,867,967 Y477F possibly damaging Het
Secisbp2l T C 2: 125,758,171 K415E probably benign Het
Stag1 C T 9: 100,888,328 T639I probably benign Het
Sv2b A T 7: 75,136,383 F430I probably benign Het
Tenm2 C T 11: 36,139,743 C743Y probably damaging Het
Tet2 C A 3: 133,487,339 V445L probably benign Het
Tmem132c T C 5: 127,554,632 S652P probably damaging Het
Togaram1 A G 12: 64,992,617 D1155G possibly damaging Het
Traip T C 9: 107,961,544 I169T probably benign Het
Usp45 T G 4: 21,816,892 M374R possibly damaging Het
Vmn2r81 A T 10: 79,268,332 H263L probably benign Het
Wdr95 T C 5: 149,581,846 V364A probably damaging Het
Zfp128 G A 7: 12,890,478 D258N probably damaging Het
Zfp335 G A 2: 164,909,418 T76I probably benign Het
Zfp688 C A 7: 127,419,311 C214F probably damaging Het
Zfp760 T C 17: 21,722,674 S277P probably damaging Het
Other mutations in Insc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00795:Insc APN 7 114842154 missense probably damaging 1.00
IGL02381:Insc APN 7 114849942 makesense probably null
IGL02515:Insc APN 7 114769008 missense probably damaging 1.00
IGL03154:Insc APN 7 114842189 missense probably null 1.00
rare UTSW 7 114791148 missense probably damaging 1.00
R0139:Insc UTSW 7 114769002 missense probably damaging 0.98
R0322:Insc UTSW 7 114792265 missense probably damaging 0.99
R0708:Insc UTSW 7 114845146 missense probably damaging 0.98
R0715:Insc UTSW 7 114845077 missense probably benign 0.06
R1864:Insc UTSW 7 114842178 missense probably benign 0.06
R2069:Insc UTSW 7 114804593 critical splice donor site probably null
R3763:Insc UTSW 7 114790972 missense probably damaging 1.00
R4432:Insc UTSW 7 114769055 intron probably benign
R5331:Insc UTSW 7 114845038 missense probably damaging 0.97
R5346:Insc UTSW 7 114804541 missense possibly damaging 0.69
R5625:Insc UTSW 7 114829067 missense probably damaging 0.99
R5715:Insc UTSW 7 114849841 missense probably benign 0.04
R5860:Insc UTSW 7 114791148 missense probably damaging 1.00
R6199:Insc UTSW 7 114791166 unclassified probably null
R7137:Insc UTSW 7 114811615 missense probably benign 0.21
R7440:Insc UTSW 7 114845043 missense possibly damaging 0.78
R7474:Insc UTSW 7 114768823 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAAGGTGACCTTATCCTAGCAGG -3'
(R):5'- AAATGCCCACTACAATGCCTTG -3'

Sequencing Primer
(F):5'- TACAGCTGCTCTTGAAACGG -3'
(R):5'- CACTACAATGCCTTGCACATG -3'
Posted On2019-10-17