Incidental Mutation 'R7504:Zfp688'
ID581672
Institutional Source Beutler Lab
Gene Symbol Zfp688
Ensembl Gene ENSMUSG00000045251
Gene Namezinc finger protein 688
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R7504 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location127418967-127422068 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 127419311 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 214 (C214F)
Ref Sequence ENSEMBL: ENSMUSP00000101907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106300] [ENSMUST00000148483]
Predicted Effect probably damaging
Transcript: ENSMUST00000106300
AA Change: C214F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101907
Gene: ENSMUSG00000045251
AA Change: C214F

DomainStartEndE-ValueType
KRAB 26 86 9.17e-32 SMART
ZnF_C2H2 181 203 5.42e-2 SMART
ZnF_C2H2 209 231 7.55e-1 SMART
low complexity region 236 252 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126756
SMART Domains Protein: ENSMUSP00000119731
Gene: ENSMUSG00000045251

DomainStartEndE-ValueType
SCOP:d1fgja_ 83 113 5e-4 SMART
Blast:ZnF_C2H2 92 113 1e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000129038
Predicted Effect probably benign
Transcript: ENSMUST00000148483
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C G 17: 14,943,653 A14G probably damaging Het
6430573F11Rik A C 8: 36,512,155 N304T probably benign Het
Btn1a1 A T 13: 23,461,716 M161K probably benign Het
Camkk2 G A 5: 122,746,308 T350I probably damaging Het
Cdc42bpg C A 19: 6,306,784 D23E possibly damaging Het
Cdkn1a T C 17: 29,098,514 L36P probably damaging Het
Dek A G 13: 47,088,035 I351T probably damaging Het
Dst T C 1: 34,201,017 Y1816H probably damaging Het
Efl1 T A 7: 82,683,049 N300K probably damaging Het
Ephx2 A G 14: 66,101,617 Y294H probably damaging Het
Fancd2 T A 6: 113,545,038 I198N probably damaging Het
Gm6502 G T 5: 94,317,047 V431L probably benign Het
Grid1 G T 14: 35,562,513 A738S probably damaging Het
Gsx2 G A 5: 75,076,399 probably null Het
Hc G A 2: 35,061,319 T22I not run Het
Hps1 T C 19: 42,766,720 D261G probably benign Het
Ift80 T C 3: 68,918,005 Y539C probably damaging Het
Insc G T 7: 114,791,298 probably null Het
Isg15 T C 4: 156,200,045 M9V probably damaging Het
Kalrn A G 16: 34,256,233 L695P unknown Het
Nars A C 18: 64,512,022 F52V probably benign Het
Nmt1 T G 11: 103,056,459 F225V probably damaging Het
Olfr1352 A G 10: 78,984,660 Y290C possibly damaging Het
Olfr143 A T 9: 38,254,243 K272N possibly damaging Het
Olfr1495 T A 19: 13,768,732 I130N probably damaging Het
Pbx3 T C 2: 34,175,924 T385A probably damaging Het
Pcdhb11 A T 18: 37,421,799 T61S probably benign Het
Rab11fip1 T C 8: 27,152,953 E606G possibly damaging Het
Rnf216 A G 5: 143,075,759 Y589H probably benign Het
Scara3 A G 14: 65,931,331 I279T possibly damaging Het
Sdk2 T A 11: 113,867,967 Y477F possibly damaging Het
Secisbp2l T C 2: 125,758,171 K415E probably benign Het
Stag1 C T 9: 100,888,328 T639I probably benign Het
Sv2b A T 7: 75,136,383 F430I probably benign Het
Tenm2 C T 11: 36,139,743 C743Y probably damaging Het
Tet2 C A 3: 133,487,339 V445L probably benign Het
Tmem132c T C 5: 127,554,632 S652P probably damaging Het
Togaram1 A G 12: 64,992,617 D1155G possibly damaging Het
Traip T C 9: 107,961,544 I169T probably benign Het
Usp45 T G 4: 21,816,892 M374R possibly damaging Het
Vmn2r81 A T 10: 79,268,332 H263L probably benign Het
Wdr95 T C 5: 149,581,846 V364A probably damaging Het
Zfp128 G A 7: 12,890,478 D258N probably damaging Het
Zfp335 G A 2: 164,909,418 T76I probably benign Het
Zfp760 T C 17: 21,722,674 S277P probably damaging Het
Other mutations in Zfp688
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03286:Zfp688 APN 7 127419531 missense probably benign 0.00
R1051:Zfp688 UTSW 7 127419225 missense probably damaging 1.00
R1893:Zfp688 UTSW 7 127419237 missense probably damaging 1.00
R4804:Zfp688 UTSW 7 127421885 missense probably damaging 1.00
R4970:Zfp688 UTSW 7 127419155 missense probably damaging 1.00
R7179:Zfp688 UTSW 7 127419312 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTTCAACTCCAGGCTCC -3'
(R):5'- CAGACCAGATAGCAGGTGTG -3'

Sequencing Primer
(F):5'- AGGCGGCCATTCAACTC -3'
(R):5'- CAGGTGTGCAGCTTCCTGTC -3'
Posted On2019-10-17