Incidental Mutation 'R7504:Zfp688'
ID 581672
Institutional Source Beutler Lab
Gene Symbol Zfp688
Ensembl Gene ENSMUSG00000045251
Gene Name zinc finger protein 688
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock # R7504 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 127418967-127422068 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 127419311 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 214 (C214F)
Ref Sequence ENSEMBL: ENSMUSP00000101907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106300] [ENSMUST00000148483]
AlphaFold E9Q5M9
Predicted Effect probably damaging
Transcript: ENSMUST00000106300
AA Change: C214F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101907
Gene: ENSMUSG00000045251
AA Change: C214F

DomainStartEndE-ValueType
KRAB 26 86 9.17e-32 SMART
ZnF_C2H2 181 203 5.42e-2 SMART
ZnF_C2H2 209 231 7.55e-1 SMART
low complexity region 236 252 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126756
SMART Domains Protein: ENSMUSP00000119731
Gene: ENSMUSG00000045251

DomainStartEndE-ValueType
SCOP:d1fgja_ 83 113 5e-4 SMART
Blast:ZnF_C2H2 92 113 1e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000129038
Predicted Effect probably benign
Transcript: ENSMUST00000148483
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C G 17: 14,943,653 A14G probably damaging Het
6430573F11Rik A C 8: 36,512,155 N304T probably benign Het
Btn1a1 A T 13: 23,461,716 M161K probably benign Het
Camkk2 G A 5: 122,746,308 T350I probably damaging Het
Cdc42bpg C A 19: 6,306,784 D23E possibly damaging Het
Cdkn1a T C 17: 29,098,514 L36P probably damaging Het
Dek A G 13: 47,088,035 I351T probably damaging Het
Dst T C 1: 34,201,017 Y1816H probably damaging Het
Efl1 T A 7: 82,683,049 N300K probably damaging Het
Ephx2 A G 14: 66,101,617 Y294H probably damaging Het
Fancd2 T A 6: 113,545,038 I198N probably damaging Het
Gm6502 G T 5: 94,317,047 V431L probably benign Het
Grid1 G T 14: 35,562,513 A738S probably damaging Het
Gsx2 G A 5: 75,076,399 probably null Het
Hc G A 2: 35,061,319 T22I not run Het
Hps1 T C 19: 42,766,720 D261G probably benign Het
Ift80 T C 3: 68,918,005 Y539C probably damaging Het
Insc G T 7: 114,791,298 probably null Het
Isg15 T C 4: 156,200,045 M9V probably damaging Het
Kalrn A G 16: 34,256,233 L695P unknown Het
Nars A C 18: 64,512,022 F52V probably benign Het
Nmt1 T G 11: 103,056,459 F225V probably damaging Het
Olfr1352 A G 10: 78,984,660 Y290C possibly damaging Het
Olfr143 A T 9: 38,254,243 K272N possibly damaging Het
Olfr1495 T A 19: 13,768,732 I130N probably damaging Het
Pbx3 T C 2: 34,175,924 T385A probably damaging Het
Pcdhb11 A T 18: 37,421,799 T61S probably benign Het
Rab11fip1 T C 8: 27,152,953 E606G possibly damaging Het
Rnf216 A G 5: 143,075,759 Y589H probably benign Het
Scara3 A G 14: 65,931,331 I279T possibly damaging Het
Sdk2 T A 11: 113,867,967 Y477F possibly damaging Het
Secisbp2l T C 2: 125,758,171 K415E probably benign Het
Stag1 C T 9: 100,888,328 T639I probably benign Het
Sv2b A T 7: 75,136,383 F430I probably benign Het
Tenm2 C T 11: 36,139,743 C743Y probably damaging Het
Tet2 C A 3: 133,487,339 V445L probably benign Het
Tmem132c T C 5: 127,554,632 S652P probably damaging Het
Togaram1 A G 12: 64,992,617 D1155G possibly damaging Het
Traip T C 9: 107,961,544 I169T probably benign Het
Usp45 T G 4: 21,816,892 M374R possibly damaging Het
Vmn2r81 A T 10: 79,268,332 H263L probably benign Het
Wdr95 T C 5: 149,581,846 V364A probably damaging Het
Zfp128 G A 7: 12,890,478 D258N probably damaging Het
Zfp335 G A 2: 164,909,418 T76I probably benign Het
Zfp760 T C 17: 21,722,674 S277P probably damaging Het
Other mutations in Zfp688
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03286:Zfp688 APN 7 127419531 missense probably benign 0.00
R1051:Zfp688 UTSW 7 127419225 missense probably damaging 1.00
R1893:Zfp688 UTSW 7 127419237 missense probably damaging 1.00
R4804:Zfp688 UTSW 7 127421885 missense probably damaging 1.00
R4970:Zfp688 UTSW 7 127419155 missense probably damaging 1.00
R7179:Zfp688 UTSW 7 127419312 missense probably damaging 1.00
R9330:Zfp688 UTSW 7 127421905 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTTCAACTCCAGGCTCC -3'
(R):5'- CAGACCAGATAGCAGGTGTG -3'

Sequencing Primer
(F):5'- AGGCGGCCATTCAACTC -3'
(R):5'- CAGGTGTGCAGCTTCCTGTC -3'
Posted On 2019-10-17