Incidental Mutation 'R7504:Rab11fip1'
ID581673
Institutional Source Beutler Lab
Gene Symbol Rab11fip1
Ensembl Gene ENSMUSG00000031488
Gene NameRAB11 family interacting protein 1 (class I)
Synonyms4833414G05Rik, 2010200K21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R7504 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location27138773-27174646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27152953 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 606 (E606G)
Ref Sequence ENSEMBL: ENSMUSP00000058042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033878] [ENSMUST00000054212] [ENSMUST00000209377]
Predicted Effect probably benign
Transcript: ENSMUST00000033878
SMART Domains Protein: ENSMUSP00000033878
Gene: ENSMUSG00000031488

DomainStartEndE-ValueType
C2 19 125 1.57e-13 SMART
low complexity region 173 185 N/A INTRINSIC
low complexity region 201 227 N/A INTRINSIC
low complexity region 260 273 N/A INTRINSIC
low complexity region 373 396 N/A INTRINSIC
low complexity region 423 438 N/A INTRINSIC
Pfam:RBD-FIP 588 635 6.1e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000054212
AA Change: E606G

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058042
Gene: ENSMUSG00000031488
AA Change: E606G

DomainStartEndE-ValueType
C2 19 125 1.57e-13 SMART
low complexity region 173 185 N/A INTRINSIC
low complexity region 201 227 N/A INTRINSIC
low complexity region 260 273 N/A INTRINSIC
low complexity region 373 396 N/A INTRINSIC
low complexity region 423 438 N/A INTRINSIC
low complexity region 582 600 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
low complexity region 745 757 N/A INTRINSIC
low complexity region 882 893 N/A INTRINSIC
low complexity region 976 983 N/A INTRINSIC
low complexity region 992 999 N/A INTRINSIC
Pfam:RBD-FIP 1109 1156 3.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209377
AA Change: E606G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.0693 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the Rab11-family interacting proteins (Rab11-FIPs), which play a role in the Rab-11 mediated recycling of vesicles. The encoded protein may be involved in endocytic sorting, trafficking of proteins including integrin subunits and epidermal growth factor receptor (EGFR), and transport between the recycling endosome and the trans-Golgi network. Alternative splicing results in multiple transcript variants. A pseudogene is described on the X chromosome. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous knockout results in reduced metastatic potential of pancreatic adenocarcinoma (PDAC) tumor cells in KPC (PDAC model) mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C G 17: 14,943,653 A14G probably damaging Het
6430573F11Rik A C 8: 36,512,155 N304T probably benign Het
Btn1a1 A T 13: 23,461,716 M161K probably benign Het
Camkk2 G A 5: 122,746,308 T350I probably damaging Het
Cdc42bpg C A 19: 6,306,784 D23E possibly damaging Het
Cdkn1a T C 17: 29,098,514 L36P probably damaging Het
Dek A G 13: 47,088,035 I351T probably damaging Het
Dst T C 1: 34,201,017 Y1816H probably damaging Het
Efl1 T A 7: 82,683,049 N300K probably damaging Het
Ephx2 A G 14: 66,101,617 Y294H probably damaging Het
Fancd2 T A 6: 113,545,038 I198N probably damaging Het
Gm6502 G T 5: 94,317,047 V431L probably benign Het
Grid1 G T 14: 35,562,513 A738S probably damaging Het
Gsx2 G A 5: 75,076,399 probably null Het
Hc G A 2: 35,061,319 T22I not run Het
Hps1 T C 19: 42,766,720 D261G probably benign Het
Ift80 T C 3: 68,918,005 Y539C probably damaging Het
Insc G T 7: 114,791,298 probably null Het
Isg15 T C 4: 156,200,045 M9V probably damaging Het
Kalrn A G 16: 34,256,233 L695P unknown Het
Nars A C 18: 64,512,022 F52V probably benign Het
Nmt1 T G 11: 103,056,459 F225V probably damaging Het
Olfr1352 A G 10: 78,984,660 Y290C possibly damaging Het
Olfr143 A T 9: 38,254,243 K272N possibly damaging Het
Olfr1495 T A 19: 13,768,732 I130N probably damaging Het
Pbx3 T C 2: 34,175,924 T385A probably damaging Het
Pcdhb11 A T 18: 37,421,799 T61S probably benign Het
Rnf216 A G 5: 143,075,759 Y589H probably benign Het
Scara3 A G 14: 65,931,331 I279T possibly damaging Het
Sdk2 T A 11: 113,867,967 Y477F possibly damaging Het
Secisbp2l T C 2: 125,758,171 K415E probably benign Het
Stag1 C T 9: 100,888,328 T639I probably benign Het
Sv2b A T 7: 75,136,383 F430I probably benign Het
Tenm2 C T 11: 36,139,743 C743Y probably damaging Het
Tet2 C A 3: 133,487,339 V445L probably benign Het
Tmem132c T C 5: 127,554,632 S652P probably damaging Het
Togaram1 A G 12: 64,992,617 D1155G possibly damaging Het
Traip T C 9: 107,961,544 I169T probably benign Het
Usp45 T G 4: 21,816,892 M374R possibly damaging Het
Vmn2r81 A T 10: 79,268,332 H263L probably benign Het
Wdr95 T C 5: 149,581,846 V364A probably damaging Het
Zfp128 G A 7: 12,890,478 D258N probably damaging Het
Zfp335 G A 2: 164,909,418 T76I probably benign Het
Zfp688 C A 7: 127,419,311 C214F probably damaging Het
Zfp760 T C 17: 21,722,674 S277P probably damaging Het
Other mutations in Rab11fip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Rab11fip1 APN 8 27154776 missense possibly damaging 0.71
IGL01976:Rab11fip1 APN 8 27152797 missense possibly damaging 0.56
IGL02832:Rab11fip1 APN 8 27152812 missense possibly damaging 0.79
IGL02799:Rab11fip1 UTSW 8 27152760 missense probably benign 0.12
R0046:Rab11fip1 UTSW 8 27153121 missense probably damaging 0.99
R0046:Rab11fip1 UTSW 8 27153121 missense probably damaging 0.99
R0145:Rab11fip1 UTSW 8 27143324 missense probably damaging 1.00
R0243:Rab11fip1 UTSW 8 27152225 missense probably damaging 1.00
R0427:Rab11fip1 UTSW 8 27154492 missense probably damaging 0.99
R1341:Rab11fip1 UTSW 8 27143360 missense probably damaging 0.99
R1487:Rab11fip1 UTSW 8 27154212 missense probably damaging 0.99
R1509:Rab11fip1 UTSW 8 27153023 missense probably damaging 1.00
R1731:Rab11fip1 UTSW 8 27152410 missense probably damaging 0.98
R3832:Rab11fip1 UTSW 8 27152746 missense probably benign
R4157:Rab11fip1 UTSW 8 27152147 missense probably damaging 1.00
R4451:Rab11fip1 UTSW 8 27154477 missense probably damaging 1.00
R4595:Rab11fip1 UTSW 8 27154575 missense probably damaging 0.98
R4620:Rab11fip1 UTSW 8 27154215 missense probably damaging 1.00
R4753:Rab11fip1 UTSW 8 27152741 missense probably benign
R4834:Rab11fip1 UTSW 8 27153083 missense probably damaging 1.00
R4958:Rab11fip1 UTSW 8 27154813 missense probably damaging 0.99
R5102:Rab11fip1 UTSW 8 27156374 missense probably damaging 0.99
R5558:Rab11fip1 UTSW 8 27151975 missense probably damaging 1.00
R5752:Rab11fip1 UTSW 8 27156586 missense probably damaging 0.99
R5859:Rab11fip1 UTSW 8 27154720 missense probably damaging 1.00
R6525:Rab11fip1 UTSW 8 27156499 missense probably benign 0.45
R6527:Rab11fip1 UTSW 8 27174392 missense probably damaging 0.99
R6551:Rab11fip1 UTSW 8 27156484 missense probably damaging 0.96
R6695:Rab11fip1 UTSW 8 27143234 missense probably damaging 1.00
R6730:Rab11fip1 UTSW 8 27143229 missense probably damaging 1.00
R6810:Rab11fip1 UTSW 8 27152732 frame shift probably null
R6925:Rab11fip1 UTSW 8 27152972 missense probably damaging 1.00
R6941:Rab11fip1 UTSW 8 27156275 nonsense probably null
R7481:Rab11fip1 UTSW 8 27156581 missense probably damaging 1.00
R7610:Rab11fip1 UTSW 8 27152036 missense probably benign 0.19
R8264:Rab11fip1 UTSW 8 27152480 nonsense probably null
R8360:Rab11fip1 UTSW 8 27152346 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCCGATTCATCACTGCCAG -3'
(R):5'- GACTGGAAGTTTCTCCAGAGGC -3'

Sequencing Primer
(F):5'- GATTCATCACTGCCAGCTTCC -3'
(R):5'- AAGTTTCTCCAGAGGCTCAGC -3'
Posted On2019-10-17